\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).


Sorry, variation is wrong, please check.

Detailed information for vg0526996345:

Variant ID: vg0526996345 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 26996345
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


AATCTAAAGATGCTATGAAGTTGACATGTCCATATTTCTCACCCTTCTCTCTAATTGTACTGCTTTTTAAGGCTTTGATTAAGCTGTATTGAATCTAACA[C/T]
ATTGCAAATAACAAAAAATGAATCAAATACTTGTGAAACGAGCAAGACATTTTAGTACAAATGTTAAAAAGGGAAACAGTCAATATACCCACCTAAAGTG

Reverse complement sequence

CACTTTAGGTGGGTATATTGACTGTTTCCCTTTTTAACATTTGTACTAAAATGTCTTGCTCGTTTCACAAGTATTTGATTCATTTTTTGTTATTTGCAAT[G/A]
TGTTAGATTCAATACAGCTTAATCAAAGCCTTAAAAAGCAGTACAATTAGAGAGAAGGGTGAGAAATATGGACATGTCAACTTCATAGCATCTTTAGATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.30% 34.20% 0.08% 0.40% NA
All Indica  2759 56.20% 43.10% 0.14% 0.62% NA
All Japonica  1512 74.50% 25.50% 0.00% 0.07% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 60.80% 38.70% 0.00% 0.50% NA
Indica II  465 66.50% 33.30% 0.22% 0.00% NA
Indica III  913 50.80% 48.20% 0.11% 0.88% NA
Indica Intermediate  786 52.80% 46.20% 0.25% 0.76% NA
Temperate Japonica  767 96.10% 3.80% 0.00% 0.13% NA
Tropical Japonica  504 38.90% 61.10% 0.00% 0.00% NA
Japonica Intermediate  241 80.10% 19.90% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 66.70% 32.20% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0526996345 C -> T LOC_Os05g46630.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:60.956; most accessible tissue: Minghui63 flower, score: 83.722 N N N N
vg0526996345 C -> T LOC_Os05g46620.1 upstream_gene_variant ; 1184.0bp to feature; MODIFIER silent_mutation Average:60.956; most accessible tissue: Minghui63 flower, score: 83.722 N N N N
vg0526996345 C -> T LOC_Os05g46640.1 upstream_gene_variant ; 3292.0bp to feature; MODIFIER silent_mutation Average:60.956; most accessible tissue: Minghui63 flower, score: 83.722 N N N N
vg0526996345 C -> T LOC_Os05g46630.2 intron_variant ; MODIFIER silent_mutation Average:60.956; most accessible tissue: Minghui63 flower, score: 83.722 N N N N
vg0526996345 C -> DEL N N silent_mutation Average:60.956; most accessible tissue: Minghui63 flower, score: 83.722 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0526996345 NA 9.61E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996345 NA 5.47E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996345 NA 1.56E-06 mr1189 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996345 3.60E-07 1.27E-13 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996345 NA 2.03E-06 mr1457 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996345 NA 7.97E-06 mr1477 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996345 NA 6.63E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996345 NA 4.30E-07 mr1625 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996345 NA 1.67E-06 mr1642 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996345 NA 1.14E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996345 NA 5.57E-06 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996345 1.75E-06 1.75E-06 mr1782 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996345 NA 6.57E-06 mr1786 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996345 NA 7.49E-06 mr1892 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996345 NA 2.12E-06 mr1990 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996345 NA 1.18E-06 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996345 NA 5.54E-07 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996345 NA 1.51E-06 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996345 NA 6.16E-07 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996345 NA 7.72E-07 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996345 NA 9.18E-07 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996345 NA 9.40E-06 mr1377_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996345 NA 1.09E-06 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996345 NA 1.21E-06 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996345 NA 1.81E-06 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251