\
| Variant ID: vg0526996345 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 26996345 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 254. )
AATCTAAAGATGCTATGAAGTTGACATGTCCATATTTCTCACCCTTCTCTCTAATTGTACTGCTTTTTAAGGCTTTGATTAAGCTGTATTGAATCTAACA[C/T]
ATTGCAAATAACAAAAAATGAATCAAATACTTGTGAAACGAGCAAGACATTTTAGTACAAATGTTAAAAAGGGAAACAGTCAATATACCCACCTAAAGTG
CACTTTAGGTGGGTATATTGACTGTTTCCCTTTTTAACATTTGTACTAAAATGTCTTGCTCGTTTCACAAGTATTTGATTCATTTTTTGTTATTTGCAAT[G/A]
TGTTAGATTCAATACAGCTTAATCAAAGCCTTAAAAAGCAGTACAATTAGAGAGAAGGGTGAGAAATATGGACATGTCAACTTCATAGCATCTTTAGATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.30% | 34.20% | 0.08% | 0.40% | NA |
| All Indica | 2759 | 56.20% | 43.10% | 0.14% | 0.62% | NA |
| All Japonica | 1512 | 74.50% | 25.50% | 0.00% | 0.07% | NA |
| Aus | 269 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 60.80% | 38.70% | 0.00% | 0.50% | NA |
| Indica II | 465 | 66.50% | 33.30% | 0.22% | 0.00% | NA |
| Indica III | 913 | 50.80% | 48.20% | 0.11% | 0.88% | NA |
| Indica Intermediate | 786 | 52.80% | 46.20% | 0.25% | 0.76% | NA |
| Temperate Japonica | 767 | 96.10% | 3.80% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 38.90% | 61.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 80.10% | 19.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 32.20% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0526996345 | C -> T | LOC_Os05g46630.1 | splice_region_variant&intron_variant ; LOW | silent_mutation | Average:60.956; most accessible tissue: Minghui63 flower, score: 83.722 | N | N | N | N |
| vg0526996345 | C -> T | LOC_Os05g46620.1 | upstream_gene_variant ; 1184.0bp to feature; MODIFIER | silent_mutation | Average:60.956; most accessible tissue: Minghui63 flower, score: 83.722 | N | N | N | N |
| vg0526996345 | C -> T | LOC_Os05g46640.1 | upstream_gene_variant ; 3292.0bp to feature; MODIFIER | silent_mutation | Average:60.956; most accessible tissue: Minghui63 flower, score: 83.722 | N | N | N | N |
| vg0526996345 | C -> T | LOC_Os05g46630.2 | intron_variant ; MODIFIER | silent_mutation | Average:60.956; most accessible tissue: Minghui63 flower, score: 83.722 | N | N | N | N |
| vg0526996345 | C -> DEL | N | N | silent_mutation | Average:60.956; most accessible tissue: Minghui63 flower, score: 83.722 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0526996345 | NA | 9.61E-06 | mr1063 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526996345 | NA | 5.47E-06 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526996345 | NA | 1.56E-06 | mr1189 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526996345 | 3.60E-07 | 1.27E-13 | mr1194 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526996345 | NA | 2.03E-06 | mr1457 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526996345 | NA | 7.97E-06 | mr1477 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526996345 | NA | 6.63E-06 | mr1625 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526996345 | NA | 4.30E-07 | mr1625 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526996345 | NA | 1.67E-06 | mr1642 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526996345 | NA | 1.14E-06 | mr1668 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526996345 | NA | 5.57E-06 | mr1782 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526996345 | 1.75E-06 | 1.75E-06 | mr1782 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526996345 | NA | 6.57E-06 | mr1786 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526996345 | NA | 7.49E-06 | mr1892 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526996345 | NA | 2.12E-06 | mr1990 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526996345 | NA | 1.18E-06 | mr1129_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526996345 | NA | 5.54E-07 | mr1194_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526996345 | NA | 1.51E-06 | mr1253_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526996345 | NA | 6.16E-07 | mr1255_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526996345 | NA | 7.72E-07 | mr1257_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526996345 | NA | 9.18E-07 | mr1317_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526996345 | NA | 9.40E-06 | mr1377_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526996345 | NA | 1.09E-06 | mr1435_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526996345 | NA | 1.21E-06 | mr1610_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526996345 | NA | 1.81E-06 | mr1818_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |