\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0526996090:

Variant ID: vg0526996090 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 26996090
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.02, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


AGCAGTGCTTGCCATCTATAGGCGGATTTTGGAGATCCAGACACACCACATACTCGTCATTAATAAAGGAGCGTCCCCCTGTTATTAACAGAATTAGGAT[T/A]
AGGAACATAATAATTACATGGTTCAAAGAACTTTAACCAGTGATTCCATACTAACCAATTCTCCTTTTCTCCTCAAGAGATACAATGCAGGTCGGCACCA

Reverse complement sequence

TGGTGCCGACCTGCATTGTATCTCTTGAGGAGAAAAGGAGAATTGGTTAGTATGGAATCACTGGTTAAAGTTCTTTGAACCATGTAATTATTATGTTCCT[A/T]
ATCCTAATTCTGTTAATAACAGGGGGACGCTCCTTTATTAATGACGAGTATGTGGTGTGTCTGGATCTCCAAAATCCGCCTATAGATGGCAAGCACTGCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.90% 43.70% 0.11% 0.38% NA
All Indica  2759 50.30% 48.90% 0.18% 0.58% NA
All Japonica  1512 57.40% 42.50% 0.00% 0.07% NA
Aus  269 97.40% 2.60% 0.00% 0.00% NA
Indica I  595 60.80% 38.70% 0.00% 0.50% NA
Indica II  465 37.00% 62.80% 0.22% 0.00% NA
Indica III  913 52.40% 46.70% 0.22% 0.77% NA
Indica Intermediate  786 47.80% 51.10% 0.25% 0.76% NA
Temperate Japonica  767 95.20% 4.70% 0.00% 0.13% NA
Tropical Japonica  504 3.20% 96.80% 0.00% 0.00% NA
Japonica Intermediate  241 50.60% 49.40% 0.00% 0.00% NA
VI/Aromatic  96 80.20% 19.80% 0.00% 0.00% NA
Intermediate  90 50.00% 48.90% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0526996090 T -> DEL N N silent_mutation Average:75.234; most accessible tissue: Minghui63 flower, score: 89.852 N N N N
vg0526996090 T -> A LOC_Os05g46620.1 upstream_gene_variant ; 929.0bp to feature; MODIFIER silent_mutation Average:75.234; most accessible tissue: Minghui63 flower, score: 89.852 N N N N
vg0526996090 T -> A LOC_Os05g46640.1 upstream_gene_variant ; 3547.0bp to feature; MODIFIER silent_mutation Average:75.234; most accessible tissue: Minghui63 flower, score: 89.852 N N N N
vg0526996090 T -> A LOC_Os05g46630.1 intron_variant ; MODIFIER silent_mutation Average:75.234; most accessible tissue: Minghui63 flower, score: 89.852 N N N N
vg0526996090 T -> A LOC_Os05g46630.2 intron_variant ; MODIFIER silent_mutation Average:75.234; most accessible tissue: Minghui63 flower, score: 89.852 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0526996090 T A 0.02 0.0 0.0 -0.01 0.03 0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0526996090 8.54E-06 3.19E-06 mr1047 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996090 NA 1.76E-15 mr1115 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996090 NA 6.57E-06 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996090 NA 4.35E-06 mr1265 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996090 NA 3.45E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996090 NA 6.82E-06 mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996090 NA 1.58E-10 mr1454 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996090 NA 3.44E-06 mr1471 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996090 1.32E-06 2.09E-06 mr1530 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996090 NA 1.81E-12 mr1611 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996090 NA 5.64E-06 mr1625 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996090 NA 2.03E-06 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996090 NA 9.64E-06 mr1630 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996090 NA 7.29E-06 mr1642 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996090 2.57E-06 2.57E-06 mr1782 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996090 NA 2.02E-11 mr1920 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996090 NA 1.59E-07 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996090 6.91E-06 4.29E-06 mr1990 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996090 NA 3.50E-08 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996090 NA 2.47E-08 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996090 NA 4.86E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996090 NA 4.49E-10 mr1454_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996090 NA 1.77E-10 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996090 NA 3.71E-10 mr1552_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996090 NA 1.19E-07 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996090 NA 2.42E-08 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996090 NA 2.82E-09 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526996090 NA 2.95E-08 mr1879_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251