\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0526991032:

Variant ID: vg0526991032 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 26991032
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.68, A: 0.32, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


AGCTTGGCACCGTGAGGTCAGCTCATGCTCCGTCGTGAGGCCCCGTCTTTTTACTTATACTTATATTTATCAGCTAAGTAAAATTTAAATTTTCAGCCTT[G/A]
AACTTGAAGTTGATTTTAGTGTTTTCTTCAAAATTTATTTTTCAGCTTTTGTTTTTAGATCACTAGAAACATGTATATAAAAATTTAAATATGGTGTTTA

Reverse complement sequence

TAAACACCATATTTAAATTTTTATATACATGTTTCTAGTGATCTAAAAACAAAAGCTGAAAAATAAATTTTGAAGAAAACACTAAAATCAACTTCAAGTT[C/T]
AAGGCTGAAAATTTAAATTTTACTTAGCTGATAAATATAAGTATAAGTAAAAAGACGGGGCCTCACGACGGAGCATGAGCTGACCTCACGGTGCCAAGCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.90% 38.80% 0.28% 0.00% NA
All Indica  2759 48.70% 50.80% 0.47% 0.00% NA
All Japonica  1512 74.40% 25.60% 0.00% 0.00% NA
Aus  269 97.40% 2.60% 0.00% 0.00% NA
Indica I  595 58.80% 40.30% 0.84% 0.00% NA
Indica II  465 49.00% 50.80% 0.22% 0.00% NA
Indica III  913 45.00% 54.70% 0.33% 0.00% NA
Indica Intermediate  786 45.30% 54.20% 0.51% 0.00% NA
Temperate Japonica  767 96.10% 3.90% 0.00% 0.00% NA
Tropical Japonica  504 38.70% 61.30% 0.00% 0.00% NA
Japonica Intermediate  241 80.10% 19.90% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 65.60% 34.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0526991032 G -> A LOC_Os05g46610.1 downstream_gene_variant ; 1955.0bp to feature; MODIFIER silent_mutation Average:92.613; most accessible tissue: Minghui63 flower, score: 96.819 N N N N
vg0526991032 G -> A LOC_Os05g46620.1 downstream_gene_variant ; 210.0bp to feature; MODIFIER silent_mutation Average:92.613; most accessible tissue: Minghui63 flower, score: 96.819 N N N N
vg0526991032 G -> A LOC_Os05g46630.1 downstream_gene_variant ; 4702.0bp to feature; MODIFIER silent_mutation Average:92.613; most accessible tissue: Minghui63 flower, score: 96.819 N N N N
vg0526991032 G -> A LOC_Os05g46630.2 downstream_gene_variant ; 4707.0bp to feature; MODIFIER silent_mutation Average:92.613; most accessible tissue: Minghui63 flower, score: 96.819 N N N N
vg0526991032 G -> A LOC_Os05g46610-LOC_Os05g46620 intergenic_region ; MODIFIER silent_mutation Average:92.613; most accessible tissue: Minghui63 flower, score: 96.819 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0526991032 G A -0.02 0.01 0.03 0.02 0.02 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0526991032 NA 9.61E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526991032 NA 1.73E-08 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526991032 3.60E-07 1.27E-13 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526991032 NA 1.64E-06 mr1347 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526991032 NA 1.14E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526991032 NA 8.38E-06 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526991032 NA 6.57E-06 mr1786 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526991032 NA 1.92E-07 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526991032 3.37E-06 NA mr1194_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526991032 NA 5.54E-07 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526991032 NA 1.60E-07 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526991032 NA 5.68E-08 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526991032 NA 1.01E-07 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526991032 NA 6.64E-08 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526991032 NA 2.57E-06 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526991032 NA 5.96E-07 mr1377_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526991032 NA 8.38E-06 mr1423_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526991032 NA 6.50E-08 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526991032 NA 5.31E-09 mr1599_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526991032 NA 2.71E-06 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526991032 NA 6.10E-06 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251