\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0526989740:

Variant ID: vg0526989740 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 26989740
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


GTCCCCATACAAAATTAGCCCCATTAGCACCCCTTGGAGGGGCTAATGTTTTGAGAGAGGCTAATTCATATTAGCTCAAAATTAGTCCACATGTTTGGAT[T/C]
CTTAAGGGCTAATTTGAGGCTAAAAGGTGAGGGCTAAACATTAGCCCATGGAACCAAACAGGACCCAATTATGGTAGCGTGCAACTAAAATTAATTAATT

Reverse complement sequence

AATTAATTAATTTTAGTTGCACGCTACCATAATTGGGTCCTGTTTGGTTCCATGGGCTAATGTTTAGCCCTCACCTTTTAGCCTCAAATTAGCCCTTAAG[A/G]
ATCCAAACATGTGGACTAATTTTGAGCTAATATGAATTAGCCTCTCTCAAAACATTAGCCCCTCCAAGGGGTGCTAATGGGGCTAATTTTGTATGGGGAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.80% 35.00% 0.25% 0.00% NA
All Indica  2759 53.60% 46.00% 0.36% 0.00% NA
All Japonica  1512 83.10% 16.90% 0.00% 0.00% NA
Aus  269 77.00% 23.00% 0.00% 0.00% NA
Indica I  595 40.00% 59.30% 0.67% 0.00% NA
Indica II  465 54.00% 45.20% 0.86% 0.00% NA
Indica III  913 57.10% 42.90% 0.00% 0.00% NA
Indica Intermediate  786 59.80% 39.90% 0.25% 0.00% NA
Temperate Japonica  767 99.00% 1.00% 0.00% 0.00% NA
Tropical Japonica  504 64.70% 35.30% 0.00% 0.00% NA
Japonica Intermediate  241 71.00% 29.00% 0.00% 0.00% NA
VI/Aromatic  96 68.80% 30.20% 1.04% 0.00% NA
Intermediate  90 57.80% 41.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0526989740 T -> C LOC_Os05g46610.1 downstream_gene_variant ; 663.0bp to feature; MODIFIER silent_mutation Average:89.338; most accessible tissue: Minghui63 young leaf, score: 95.559 N N N N
vg0526989740 T -> C LOC_Os05g46620.1 downstream_gene_variant ; 1502.0bp to feature; MODIFIER silent_mutation Average:89.338; most accessible tissue: Minghui63 young leaf, score: 95.559 N N N N
vg0526989740 T -> C LOC_Os05g46610-LOC_Os05g46620 intergenic_region ; MODIFIER silent_mutation Average:89.338; most accessible tissue: Minghui63 young leaf, score: 95.559 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0526989740 T C -0.04 -0.05 -0.03 0.0 0.0 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0526989740 NA 3.91E-06 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526989740 NA 5.35E-09 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526989740 NA 7.27E-06 mr1057_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526989740 NA 2.46E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526989740 NA 2.41E-07 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526989740 NA 4.52E-06 mr1243_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526989740 NA 4.16E-07 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526989740 NA 5.30E-07 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526989740 NA 1.45E-06 mr1377_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526989740 NA 3.31E-07 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526989740 3.47E-06 5.85E-06 mr1555_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526989740 NA 3.38E-07 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526989740 NA 4.39E-06 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526989740 2.91E-06 NA mr1661_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526989740 6.52E-07 3.90E-06 mr1661_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526989740 NA 3.64E-06 mr1723_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526989740 NA 3.75E-06 mr1733_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526989740 NA 8.75E-06 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526989740 NA 5.20E-07 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526989740 NA 5.86E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526989740 5.76E-06 5.76E-06 mr1967_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251