\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0526981407:

Variant ID: vg0526981407 (JBrowse)Variation Type: INDEL
Chromosome: chr05Position: 26981407
Reference Allele: TAlternative Allele: TAA,TA,A,TTA,TTAA,TAAAA
Primary Allele: TAASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTAGACATATATATCTATCTAGATTCATTAATATCAATATGGATGTAAAAAATGCTAGAATGACTTACATTATGAAACAGAGAAAGTATTAGTTTTTTT[T/TAA,TA,A,TTA,TTAA,TAAAA]
AAAAAATATATCAATATAATTTTTTAAGCAACTTTCGTATATAAGCTTTTTATAAAAAATACAATATTTAGCAGATTGAAAAACGTGCGCGCGAAAAACG

Reverse complement sequence

CGTTTTTCGCGCGCACGTTTTTCAATCTGCTAAATATTGTATTTTTTATAAAAAGCTTATATACGAAAGTTGCTTAAAAAATTATATTGATATATTTTTT[A/TTA,TA,T,TAA,TTAA,TTTTA]
AAAAAAACTAATACTTTCTCTGTTTCATAATGTAAGTCATTCTAGCATTTTTTACATCCATATTGATATTAATGAATCTAGATAGATATATATGTCTAAA

Allele Frequencies:

Populations Population SizeFrequency of TAA(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.00% 20.20% 4.06% 0.00% A: 7.22%; TA: 5.16%; TTA: 1.40%; TAAAA: 0.02%; TTAA: 0.02%
All Indica  2759 86.10% 5.80% 2.17% 0.00% A: 2.32%; TTA: 2.14%; TA: 1.45%; TAAAA: 0.04%
All Japonica  1512 25.30% 49.20% 7.74% 0.00% A: 17.46%; TTA: 0.33%
Aus  269 21.60% 1.10% 1.86% 0.00% TA: 74.35%; A: 0.74%; TTA: 0.37%
Indica I  595 95.60% 0.80% 2.02% 0.00% A: 0.84%; TTA: 0.67%
Indica II  465 65.60% 20.20% 3.23% 0.00% A: 9.68%; TA: 1.08%; TTA: 0.22%
Indica III  913 90.70% 1.80% 0.66% 0.00% TTA: 5.26%; TA: 0.99%; A: 0.55%; TAAAA: 0.11%
Indica Intermediate  786 85.80% 5.60% 3.44% 0.00% TA: 3.31%; A: 1.15%; TTA: 0.76%
Temperate Japonica  767 3.80% 59.10% 11.99% 0.00% A: 25.03%; TTA: 0.13%
Tropical Japonica  504 60.50% 28.80% 1.98% 0.00% A: 7.94%; TTA: 0.79%
Japonica Intermediate  241 19.90% 60.60% 6.22% 0.00% A: 13.28%
VI/Aromatic  96 67.70% 20.80% 3.12% 0.00% A: 4.17%; TA: 2.08%; TTAA: 1.04%; TTA: 1.04%
Intermediate  90 52.20% 30.00% 7.78% 0.00% A: 7.78%; TA: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0526981407 T -> TAAAA LOC_Os05g46600-LOC_Os05g46610 intergenic_region ; MODIFIER silent_mutation Average:70.804; most accessible tissue: Zhenshan97 flower, score: 88.357 N N N N
vg0526981407 T -> TTAA LOC_Os05g46600-LOC_Os05g46610 intergenic_region ; MODIFIER silent_mutation Average:70.804; most accessible tissue: Zhenshan97 flower, score: 88.357 N N N N
vg0526981407 T -> TA LOC_Os05g46600-LOC_Os05g46610 intergenic_region ; MODIFIER silent_mutation Average:70.804; most accessible tissue: Zhenshan97 flower, score: 88.357 N N N N
vg0526981407 T -> TTA LOC_Os05g46600-LOC_Os05g46610 intergenic_region ; MODIFIER silent_mutation Average:70.804; most accessible tissue: Zhenshan97 flower, score: 88.357 N N N N
vg0526981407 T -> TAA LOC_Os05g46600-LOC_Os05g46610 intergenic_region ; MODIFIER silent_mutation Average:70.804; most accessible tissue: Zhenshan97 flower, score: 88.357 N N N N
vg0526981407 T -> A LOC_Os05g46600-LOC_Os05g46610 intergenic_region ; MODIFIER silent_mutation Average:70.804; most accessible tissue: Zhenshan97 flower, score: 88.357 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0526981407 T A -0.01 -0.01 -0.01 0.0 -0.01 0.0
vg0526981407 T TA 0.06 0.01 -0.15 0.0 0.04 0.05
vg0526981407 T TAA 0.21 0.1 -0.04 -0.1 -0.03 0.01
vg0526981407 T TAAAA -0.17 -0.21 -0.08 -0.08 -0.07 0.07
vg0526981407 T TTA 0.2 0.08 -0.06 -0.11 -0.04 0.0
vg0526981407 T TTAA -0.09 -0.15 -0.02 -0.12 -0.09 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0526981407 6.06E-07 8.96E-08 mr1588_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251