\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0526975009:

Variant ID: vg0526975009 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 26975009
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.02, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


ACCGAGAGCTTCCGGTGGACACGCGTCGGGTTGCGACTATAGAGTTTGGGTGCCCAAGAGCGAAGACTCGAACCCTGTAGCCATCTCTCCTCCTAGAAGA[G/T]
AATATATTTGCTATCACCAAGAACACAAGTCATGGAAGCGGCAACAAACTCGCGCTATTGCCTAGAACATGGGATTTGAAGCTCCTACCAGGGGCGGATC

Reverse complement sequence

GATCCGCCCCTGGTAGGAGCTTCAAATCCCATGTTCTAGGCAATAGCGCGAGTTTGTTGCCGCTTCCATGACTTGTGTTCTTGGTGATAGCAAATATATT[C/A]
TCTTCTAGGAGGAGAGATGGCTACAGGGTTCGAGTCTTCGCTCTTGGGCACCCAAACTCTATAGTCGCAACCCGACGCGTGTCCACCGGAAGCTCTCGGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.50% 42.90% 0.00% 0.61% NA
All Indica  2759 90.20% 9.10% 0.00% 0.72% NA
All Japonica  1512 0.90% 98.70% 0.00% 0.40% NA
Aus  269 22.30% 77.70% 0.00% 0.00% NA
Indica I  595 99.70% 0.00% 0.00% 0.34% NA
Indica II  465 65.40% 32.00% 0.00% 2.58% NA
Indica III  913 97.40% 2.60% 0.00% 0.00% NA
Indica Intermediate  786 89.30% 9.90% 0.00% 0.76% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 98.80% 0.00% 0.40% NA
Japonica Intermediate  241 0.80% 97.50% 0.00% 1.66% NA
VI/Aromatic  96 74.00% 26.00% 0.00% 0.00% NA
Intermediate  90 43.30% 53.30% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0526975009 G -> T LOC_Os05g46590.1 downstream_gene_variant ; 2039.0bp to feature; MODIFIER silent_mutation Average:58.887; most accessible tissue: Callus, score: 74.028 N N N N
vg0526975009 G -> T LOC_Os05g46600.1 downstream_gene_variant ; 510.0bp to feature; MODIFIER silent_mutation Average:58.887; most accessible tissue: Callus, score: 74.028 N N N N
vg0526975009 G -> T LOC_Os05g46600-LOC_Os05g46610 intergenic_region ; MODIFIER silent_mutation Average:58.887; most accessible tissue: Callus, score: 74.028 N N N N
vg0526975009 G -> DEL N N silent_mutation Average:58.887; most accessible tissue: Callus, score: 74.028 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0526975009 NA 3.84E-14 mr1032 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009 NA 5.65E-49 mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009 NA 1.24E-33 mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009 NA 1.20E-26 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009 NA 3.25E-24 mr1253 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009 NA 6.32E-21 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009 NA 1.78E-31 mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009 NA 1.25E-36 mr1435 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009 NA 1.48E-09 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009 NA 4.37E-36 mr1828 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009 NA 9.53E-10 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009 NA 2.39E-14 mr1938 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009 NA 2.30E-07 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009 NA 7.44E-08 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009 NA 2.73E-58 mr1109_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009 NA 5.49E-10 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009 NA 5.13E-36 mr1129_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009 NA 3.85E-09 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009 NA 1.03E-07 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009 NA 1.95E-25 mr1253_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009 NA 6.57E-06 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009 NA 5.64E-21 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009 NA 1.74E-08 mr1599_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009 NA 1.70E-09 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009 NA 8.61E-06 mr1682_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009 NA 2.41E-10 mr1828_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009 NA 3.88E-14 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251