Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0526975009:

Variant ID: vg0526975009 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 26975009
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.02, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

ACCGAGAGCTTCCGGTGGACACGCGTCGGGTTGCGACTATAGAGTTTGGGTGCCCAAGAGCGAAGACTCGAACCCTGTAGCCATCTCTCCTCCTAGAAGA[G/T]
AATATATTTGCTATCACCAAGAACACAAGTCATGGAAGCGGCAACAAACTCGCGCTATTGCCTAGAACATGGGATTTGAAGCTCCTACCAGGGGCGGATC

Reverse complement sequence

GATCCGCCCCTGGTAGGAGCTTCAAATCCCATGTTCTAGGCAATAGCGCGAGTTTGTTGCCGCTTCCATGACTTGTGTTCTTGGTGATAGCAAATATATT[C/A]
TCTTCTAGGAGGAGAGATGGCTACAGGGTTCGAGTCTTCGCTCTTGGGCACCCAAACTCTATAGTCGCAACCCGACGCGTGTCCACCGGAAGCTCTCGGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.50%	42.90%	0.00%	0.61%	NA
All Indica	2759	90.20%	9.10%	0.00%	0.72%	NA
All Japonica	1512	0.90%	98.70%	0.00%	0.40%	NA
Aus	269	22.30%	77.70%	0.00%	0.00%	NA
Indica I	595	99.70%	0.00%	0.00%	0.34%	NA
Indica II	465	65.40%	32.00%	0.00%	2.58%	NA
Indica III	913	97.40%	2.60%	0.00%	0.00%	NA
Indica Intermediate	786	89.30%	9.90%	0.00%	0.76%	NA
Temperate Japonica	767	0.90%	99.10%	0.00%	0.00%	NA
Tropical Japonica	504	0.80%	98.80%	0.00%	0.40%	NA
Japonica Intermediate	241	0.80%	97.50%	0.00%	1.66%	NA
VI/Aromatic	96	74.00%	26.00%	0.00%	0.00%	NA
Intermediate	90	43.30%	53.30%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0526975009	G -> T	LOC_Os05g46590.1	downstream_gene_variant ; 2039.0bp to feature; MODIFIER	silent_mutation	Average:58.887; most accessible tissue: Callus, score: 74.028	N	N	N	N
vg0526975009	G -> T	LOC_Os05g46600.1	downstream_gene_variant ; 510.0bp to feature; MODIFIER	silent_mutation	Average:58.887; most accessible tissue: Callus, score: 74.028	N	N	N	N
vg0526975009	G -> T	LOC_Os05g46600-LOC_Os05g46610	intergenic_region ; MODIFIER	silent_mutation	Average:58.887; most accessible tissue: Callus, score: 74.028	N	N	N	N
vg0526975009	G -> DEL	N	N	silent_mutation	Average:58.887; most accessible tissue: Callus, score: 74.028	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0526975009	NA	3.84E-14	mr1032	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009	NA	5.65E-49	mr1109	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009	NA	1.24E-33	mr1129	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009	NA	1.20E-26	mr1251	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009	NA	3.25E-24	mr1253	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009	NA	6.32E-21	mr1255	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009	NA	1.78E-31	mr1257	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009	NA	1.25E-36	mr1435	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009	NA	1.48E-09	mr1610	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009	NA	4.37E-36	mr1828	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009	NA	9.53E-10	mr1927	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009	NA	2.39E-14	mr1938	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009	NA	2.30E-07	mr1089_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009	NA	7.44E-08	mr1093_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009	NA	2.73E-58	mr1109_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009	NA	5.49E-10	mr1109_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009	NA	5.13E-36	mr1129_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009	NA	3.85E-09	mr1195_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009	NA	1.03E-07	mr1235_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009	NA	1.95E-25	mr1253_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009	NA	6.57E-06	mr1253_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009	NA	5.64E-21	mr1255_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009	NA	1.74E-08	mr1599_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009	NA	1.70E-09	mr1649_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009	NA	8.61E-06	mr1682_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009	NA	2.41E-10	mr1828_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526975009	NA	3.88E-14	mr1938_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251