Variant ID: vg0526967577 (JBrowse) | Variation Type: SNP |
Chromosome: chr05 | Position: 26967577 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 300. )
ATAATCGTCCTGTAAGAAAATATTCGTATTAATTGAAAGTAGAATAATACTCGTGGCAGTCAAATTCCTCCTGTTGTTATGTGGCAGAAATAGGAGTTAC[T/C]
TGGACTTGAAAGTATATTCCCATCTTAACAAGAATGTCTTCTACAGCACCATATTTGGTCAAGTCCTCTCCAGATAGCAACAGTGCACAAGCAACCTTTG
CAAAGGTTGCTTGTGCACTGTTGCTATCTGGAGAGGACTTGACCAAATATGGTGCTGTAGAAGACATTCTTGTTAAGATGGGAATATACTTTCAAGTCCA[A/G]
GTAACTCCTATTTCTGCCACATAACAACAGGAGGAATTTGACTGCCACGAGTATTATTCTACTTTCAATTAATACGAATATTTTCTTACAGGACGATTAT
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 90.50% | 8.50% | 0.99% | 0.00% | NA |
All Indica | 2759 | 99.70% | 0.20% | 0.07% | 0.00% | NA |
All Japonica | 1512 | 71.60% | 25.50% | 2.91% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 98.90% | 0.60% | 0.43% | 0.00% | NA |
Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 48.10% | 46.90% | 4.95% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 86.70% | 10.80% | 2.49% | 0.00% | NA |
VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0526967577 | T -> C | LOC_Os05g46580.1 | splice_region_variant&synonymous_variant ; p.Gln244Gln; LOW | synonymous_codon | Average:44.143; most accessible tissue: Callus, score: 66.693 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0526967577 | 6.85E-07 | 1.02E-14 | mr1013 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0526967577 | 2.66E-06 | 2.83E-10 | mr1013 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0526967577 | 4.59E-07 | 3.03E-16 | mr1031 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0526967577 | 9.22E-06 | 6.35E-11 | mr1031 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0526967577 | NA | 5.76E-07 | mr1034 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0526967577 | NA | 8.83E-08 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0526967577 | 5.13E-07 | 2.15E-16 | mr1056 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0526967577 | NA | 2.19E-10 | mr1056 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0526967577 | NA | 5.35E-22 | mr1163 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0526967577 | NA | 2.65E-09 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/