Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0526936018:

Variant ID: vg0526936018 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 26936018
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAACGAAAAGTTATACTTAAAGTACGGTAGATAATAAAATAAGTCACAAATAAAATAAATAATAATTTTAAAAAAAATTAAATAAGACGAGTGGTCAAAC[G/A]
TTGCAAGTAAAAACTTAAAATCTTTTATATTATGGGACGGAGGGAGTATTTTGTGTATACAATGCATGGAGACTTCTGTTATGATCAGTATATCTGCAAT

Reverse complement sequence

ATTGCAGATATACTGATCATAACAGAAGTCTCCATGCATTGTATACACAAAATACTCCCTCCGTCCCATAATATAAAAGATTTTAAGTTTTTACTTGCAA[C/T]
GTTTGACCACTCGTCTTATTTAATTTTTTTTAAAATTATTATTTATTTTATTTGTGACTTATTTTATTATCTACCGTACTTTAAGTATAACTTTTCGTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.40%	7.40%	0.15%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.00%	0.00%	NA
All Japonica	1512	77.80%	21.80%	0.40%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.30%	0.00%	0.00%	NA
Temperate Japonica	767	96.50%	3.40%	0.13%	0.00%	NA
Tropical Japonica	504	47.40%	51.60%	0.99%	0.00%	NA
Japonica Intermediate	241	81.70%	18.30%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	86.70%	12.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0526936018	G -> A	LOC_Os05g46500.1	upstream_gene_variant ; 1326.0bp to feature; MODIFIER	silent_mutation	Average:94.09; most accessible tissue: Minghui63 flower, score: 98.151	N	N	N	N
vg0526936018	G -> A	LOC_Os05g46510.1	upstream_gene_variant ; 4080.0bp to feature; MODIFIER	silent_mutation	Average:94.09; most accessible tissue: Minghui63 flower, score: 98.151	N	N	N	N
vg0526936018	G -> A	LOC_Os05g46490.1	downstream_gene_variant ; 219.0bp to feature; MODIFIER	silent_mutation	Average:94.09; most accessible tissue: Minghui63 flower, score: 98.151	N	N	N	N
vg0526936018	G -> A	LOC_Os05g46490.2	downstream_gene_variant ; 145.0bp to feature; MODIFIER	silent_mutation	Average:94.09; most accessible tissue: Minghui63 flower, score: 98.151	N	N	N	N
vg0526936018	G -> A	LOC_Os05g46490-LOC_Os05g46500	intergenic_region ; MODIFIER	silent_mutation	Average:94.09; most accessible tissue: Minghui63 flower, score: 98.151	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0526936018	G	A	-0.02	-0.03	-0.03	-0.05	-0.04	-0.04

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0526936018	NA	3.40E-06	mr1040	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526936018	NA	4.31E-06	mr1188	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526936018	1.95E-08	NA	mr1194	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526936018	4.65E-06	8.26E-14	mr1194	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526936018	NA	4.54E-06	mr1482	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526936018	NA	4.35E-06	mr1786	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526936018	NA	6.42E-06	mr1991	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526936018	7.03E-06	NA	mr1174_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526936018	NA	9.75E-06	mr1174_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526936018	NA	1.50E-06	mr1194_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526936018	NA	1.44E-07	mr1347_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526936018	NA	2.34E-07	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526936018	1.16E-06	3.23E-18	mr1715_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526936018	NA	9.18E-08	mr1715_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526936018	NA	4.08E-10	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251