\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0526919672:

Variant ID: vg0526919672 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 26919672
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


TATATATATATATTCATTAATATCAATATAAATATGAAAAATGCTAGAATGAGTTACATTGTGAAACGGAGGAAATACCATTAACTTTTTTTAAATATTT[A/G]
ATCATTTGTCTTATTCAAAAAAATTACATGTATAAAAATATTTTATGATAAATCAAGTCACAATAAAATAAATGATAATTATTTTTTTTAATAAAACGAA

Reverse complement sequence

TTCGTTTTATTAAAAAAAATAATTATCATTTATTTTATTGTGACTTGATTTATCATAAAATATTTTTATACATGTAATTTTTTTGAATAAGACAAATGAT[T/C]
AAATATTTAAAAAAAGTTAATGGTATTTCCTCCGTTTCACAATGTAACTCATTCTAGCATTTTTCATATTTATATTGATATTAATGAATATATATATATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 23.10% 8.90% 26.68% 41.30% NA
All Indica  2759 14.60% 0.30% 27.76% 57.34% NA
All Japonica  1512 42.00% 26.70% 25.07% 6.28% NA
Aus  269 3.70% 0.00% 9.67% 86.62% NA
Indica I  595 9.90% 0.00% 19.16% 70.92% NA
Indica II  465 13.50% 0.60% 31.40% 54.41% NA
Indica III  913 19.70% 0.10% 32.75% 47.43% NA
Indica Intermediate  786 13.00% 0.40% 26.34% 60.31% NA
Temperate Japonica  767 11.60% 48.60% 31.29% 8.47% NA
Tropical Japonica  504 81.20% 0.00% 16.07% 2.78% NA
Japonica Intermediate  241 56.80% 12.40% 24.07% 6.64% NA
VI/Aromatic  96 24.00% 0.00% 65.62% 10.42% NA
Intermediate  90 22.20% 12.20% 30.00% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0526919672 A -> DEL N N silent_mutation Average:89.148; most accessible tissue: Minghui63 young leaf, score: 97.361 N N N N
vg0526919672 A -> G LOC_Os05g46460.1 upstream_gene_variant ; 2213.0bp to feature; MODIFIER silent_mutation Average:89.148; most accessible tissue: Minghui63 young leaf, score: 97.361 N N N N
vg0526919672 A -> G LOC_Os05g46460.3 upstream_gene_variant ; 2213.0bp to feature; MODIFIER silent_mutation Average:89.148; most accessible tissue: Minghui63 young leaf, score: 97.361 N N N N
vg0526919672 A -> G LOC_Os05g46460.4 upstream_gene_variant ; 2213.0bp to feature; MODIFIER silent_mutation Average:89.148; most accessible tissue: Minghui63 young leaf, score: 97.361 N N N N
vg0526919672 A -> G LOC_Os05g46460.5 upstream_gene_variant ; 2213.0bp to feature; MODIFIER silent_mutation Average:89.148; most accessible tissue: Minghui63 young leaf, score: 97.361 N N N N
vg0526919672 A -> G LOC_Os05g46460.6 upstream_gene_variant ; 2213.0bp to feature; MODIFIER silent_mutation Average:89.148; most accessible tissue: Minghui63 young leaf, score: 97.361 N N N N
vg0526919672 A -> G LOC_Os05g46470.1 downstream_gene_variant ; 2474.0bp to feature; MODIFIER silent_mutation Average:89.148; most accessible tissue: Minghui63 young leaf, score: 97.361 N N N N
vg0526919672 A -> G LOC_Os05g46460-LOC_Os05g46470 intergenic_region ; MODIFIER silent_mutation Average:89.148; most accessible tissue: Minghui63 young leaf, score: 97.361 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0526919672 A G -0.02 -0.02 -0.03 -0.02 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0526919672 NA 1.18E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919672 NA 9.84E-14 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919672 NA 4.36E-09 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919672 NA 2.94E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919672 NA 6.84E-14 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919672 NA 1.10E-08 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919672 3.45E-08 1.03E-22 mr1163 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919672 NA 4.79E-11 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919672 NA 1.85E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919672 NA 6.49E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919672 NA 2.05E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251