\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0526919176:

Variant ID: vg0526919176 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 26919176
Reference Allele: AAlternative Allele: C,T
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, A: 0.15, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


AGACACAGTATGTGTATAACAGGCGGGACCAGGTATTAATAGTATAGTATGTAACTATTATATAAATGAATTATTAAATTGGCTATAGATGAATTAGAGC[A/C,T]
AGTAGTTGGCTATCCAATTAATTTTGCTCTTATCACCTATTTCTTTCCACGTGTGGCCGGCAGCGGCTGCTCCTTGCCTCGGGCTCAGTGATGCGGTGCG

Reverse complement sequence

CGCACCGCATCACTGAGCCCGAGGCAAGGAGCAGCCGCTGCCGGCCACACGTGGAAAGAAATAGGTGATAAGAGCAAAATTAATTGGATAGCCAACTACT[T/G,A]
GCTCTAATTCATCTATAGCCAATTTAATAATTCATTTATATAATAGTTACATACTATACTATTAATACCTGGTCCCGCCTGTTATACACATACTGTGTCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.40% 33.70% 0.91% 0.00% T: 0.04%
All Indica  2759 91.20% 8.30% 0.51% 0.00% T: 0.07%
All Japonica  1512 26.50% 71.90% 1.59% 0.00% NA
Aus  269 19.30% 80.70% 0.00% 0.00% NA
Indica I  595 99.50% 0.00% 0.50% 0.00% NA
Indica II  465 67.50% 31.20% 1.29% 0.00% NA
Indica III  913 98.80% 1.10% 0.00% 0.00% T: 0.11%
Indica Intermediate  786 89.90% 9.30% 0.64% 0.00% T: 0.13%
Temperate Japonica  767 47.60% 50.50% 1.96% 0.00% NA
Tropical Japonica  504 1.00% 98.60% 0.40% 0.00% NA
Japonica Intermediate  241 12.90% 84.20% 2.90% 0.00% NA
VI/Aromatic  96 76.00% 24.00% 0.00% 0.00% NA
Intermediate  90 53.30% 41.10% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0526919176 A -> T LOC_Os05g46460.1 upstream_gene_variant ; 1717.0bp to feature; MODIFIER silent_mutation Average:99.056; most accessible tissue: Minghui63 root, score: 99.794 N N N N
vg0526919176 A -> T LOC_Os05g46460.3 upstream_gene_variant ; 1717.0bp to feature; MODIFIER silent_mutation Average:99.056; most accessible tissue: Minghui63 root, score: 99.794 N N N N
vg0526919176 A -> T LOC_Os05g46460.4 upstream_gene_variant ; 1717.0bp to feature; MODIFIER silent_mutation Average:99.056; most accessible tissue: Minghui63 root, score: 99.794 N N N N
vg0526919176 A -> T LOC_Os05g46460.5 upstream_gene_variant ; 1717.0bp to feature; MODIFIER silent_mutation Average:99.056; most accessible tissue: Minghui63 root, score: 99.794 N N N N
vg0526919176 A -> T LOC_Os05g46460.6 upstream_gene_variant ; 1717.0bp to feature; MODIFIER silent_mutation Average:99.056; most accessible tissue: Minghui63 root, score: 99.794 N N N N
vg0526919176 A -> T LOC_Os05g46470.1 downstream_gene_variant ; 2970.0bp to feature; MODIFIER silent_mutation Average:99.056; most accessible tissue: Minghui63 root, score: 99.794 N N N N
vg0526919176 A -> T LOC_Os05g46460-LOC_Os05g46470 intergenic_region ; MODIFIER silent_mutation Average:99.056; most accessible tissue: Minghui63 root, score: 99.794 N N N N
vg0526919176 A -> C LOC_Os05g46460.1 upstream_gene_variant ; 1717.0bp to feature; MODIFIER silent_mutation Average:99.056; most accessible tissue: Minghui63 root, score: 99.794 N N N N
vg0526919176 A -> C LOC_Os05g46460.3 upstream_gene_variant ; 1717.0bp to feature; MODIFIER silent_mutation Average:99.056; most accessible tissue: Minghui63 root, score: 99.794 N N N N
vg0526919176 A -> C LOC_Os05g46460.4 upstream_gene_variant ; 1717.0bp to feature; MODIFIER silent_mutation Average:99.056; most accessible tissue: Minghui63 root, score: 99.794 N N N N
vg0526919176 A -> C LOC_Os05g46460.5 upstream_gene_variant ; 1717.0bp to feature; MODIFIER silent_mutation Average:99.056; most accessible tissue: Minghui63 root, score: 99.794 N N N N
vg0526919176 A -> C LOC_Os05g46460.6 upstream_gene_variant ; 1717.0bp to feature; MODIFIER silent_mutation Average:99.056; most accessible tissue: Minghui63 root, score: 99.794 N N N N
vg0526919176 A -> C LOC_Os05g46470.1 downstream_gene_variant ; 2970.0bp to feature; MODIFIER silent_mutation Average:99.056; most accessible tissue: Minghui63 root, score: 99.794 N N N N
vg0526919176 A -> C LOC_Os05g46460-LOC_Os05g46470 intergenic_region ; MODIFIER silent_mutation Average:99.056; most accessible tissue: Minghui63 root, score: 99.794 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0526919176 A C 0.01 0.02 0.04 0.03 0.02 0.03
vg0526919176 A T -0.01 -0.01 0.01 0.04 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0526919176 NA 4.27E-08 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 2.48E-12 mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 7.76E-15 mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 7.05E-09 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 5.01E-09 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 2.32E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 8.91E-06 NA mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 1.84E-08 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 1.03E-12 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 1.75E-11 mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 1.10E-07 NA mr1163 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 3.24E-06 9.46E-13 mr1163 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 7.66E-14 mr1178 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 8.33E-08 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 3.68E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 1.56E-11 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 1.58E-12 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 8.23E-12 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 8.64E-11 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 4.09E-10 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 7.83E-07 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 1.11E-07 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 1.77E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 6.04E-13 mr1022_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 8.55E-08 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 1.50E-08 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 1.38E-08 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 3.89E-07 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 3.14E-07 mr1193_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 3.46E-20 mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 7.42E-13 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 5.25E-09 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 3.55E-09 mr1241_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 1.34E-06 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 1.56E-11 mr1352_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 1.48E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 6.54E-09 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 8.78E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 3.63E-07 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 6.36E-12 mr1546_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 1.31E-07 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 5.52E-06 mr1562_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 1.37E-06 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 1.41E-09 mr1599_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 7.50E-06 mr1645_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 3.62E-06 mr1654_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 6.48E-08 mr1682_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 2.68E-10 mr1718_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 2.32E-07 mr1805_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 1.87E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 1.47E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 6.02E-08 1.59E-13 mr1828_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 5.29E-07 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 8.87E-06 mr1837_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 1.22E-07 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526919176 NA 8.10E-07 mr1938_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251