Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0526905981:

Variant ID: vg0526905981 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 26905981
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:

TCATTGTCCTAAGATGTATCACATCCACTCAAAATCTCATGTACAGATTTATTGTCCTAGGATATATCATATCCACTCAAAATCTCTTATATTATAGGAC[G/A]
GAGAGAGAATATATAATCCGCATAATAACTTACTCCCTTCGTCCCAAAAAAAAATCAATCTAGTATTGGATGAGACGTTTTCTAGTACAAAGAATCTGAA

Reverse complement sequence

TTCAGATTCTTTGTACTAGAAAACGTCTCATCCAATACTAGATTGATTTTTTTTTGGGACGAAGGGAGTAAGTTATTATGCGGATTATATATTCTCTCTC[C/T]
GTCCTATAATATAAGAGATTTTGAGTGGATATGATATATCCTAGGACAATAAATCTGTACATGAGATTTTGAGTGGATGTGATACATCTTAGGACAATGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.40%	34.80%	1.74%	0.00%	NA
All Indica	2759	86.00%	12.10%	1.85%	0.00%	NA
All Japonica	1512	29.00%	69.50%	1.46%	0.00%	NA
Aus	269	19.00%	80.30%	0.74%	0.00%	NA
Indica I	595	83.20%	10.60%	6.22%	0.00%	NA
Indica II	465	64.70%	33.30%	1.94%	0.00%	NA
Indica III	913	97.00%	3.00%	0.00%	0.00%	NA
Indica Intermediate	786	87.90%	11.50%	0.64%	0.00%	NA
Temperate Japonica	767	50.70%	47.60%	1.69%	0.00%	NA
Tropical Japonica	504	2.40%	97.20%	0.40%	0.00%	NA
Japonica Intermediate	241	15.80%	81.30%	2.90%	0.00%	NA
VI/Aromatic	96	89.60%	10.40%	0.00%	0.00%	NA
Intermediate	90	53.30%	38.90%	7.78%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0526905981	G -> A	LOC_Os05g46430.1	upstream_gene_variant ; 970.0bp to feature; MODIFIER	silent_mutation	Average:63.204; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0526905981	G -> A	LOC_Os05g46430.2	upstream_gene_variant ; 970.0bp to feature; MODIFIER	silent_mutation	Average:63.204; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0526905981	G -> A	LOC_Os05g46420.1	downstream_gene_variant ; 4444.0bp to feature; MODIFIER	silent_mutation	Average:63.204; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0526905981	G -> A	LOC_Os05g46440.1	downstream_gene_variant ; 1224.0bp to feature; MODIFIER	silent_mutation	Average:63.204; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0526905981	G -> A	LOC_Os05g46450.1	downstream_gene_variant ; 1742.0bp to feature; MODIFIER	silent_mutation	Average:63.204; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0526905981	G -> A	LOC_Os05g46430-LOC_Os05g46440	intergenic_region ; MODIFIER	silent_mutation	Average:63.204; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0526905981	1.68E-06	1.52E-10	mr1013	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526905981	8.05E-06	5.30E-11	mr1031	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526905981	NA	3.58E-07	mr1034	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526905981	NA	2.80E-10	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526905981	NA	9.62E-10	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526905981	NA	5.58E-06	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526905981	NA	1.46E-08	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526905981	NA	3.76E-06	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526905981	NA	9.29E-07	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251