Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0526901536:

Variant ID: vg0526901536 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 26901536
Reference Allele: T	Alternative Allele: C,G
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:

CGCTTGTCAGAAACTCACAATGCAAAATCATCTCCCTCACGGGTTCACATTCTCTACCATAATAACATTATCATTGCAAATACTTCAAAATATTTGACAC[T/C,G]
ATTGACTTTTTAGTACGTGTTTGACTATTCGTCTTATTCAAAAAAATTTAAGTAATTATTTATTCTTTTTATATCATTTGATTCGTTGTTAAATATAATT

Reverse complement sequence

AATTATATTTAACAACGAATCAAATGATATAAAAAGAATAAATAATTACTTAAATTTTTTTGAATAAGACGAATAGTCAAACACGTACTAAAAAGTCAAT[A/G,C]
GTGTCAAATATTTTGAAGTATTTGCAATGATAATGTTATTATGGTAGAGAATGTGAACCCGTGAGGGAGATGATTTTGCATTGTGAGTTTCTGACAAGCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	28.90%	7.50%	12.42%	45.34%	G: 5.90%
All Indica	2759	8.40%	0.10%	12.43%	69.63%	G: 9.42%
All Japonica	1512	68.20%	22.60%	8.60%	0.60%	G: 0.07%
Aus	269	16.40%	0.00%	21.19%	60.59%	G: 1.86%
Indica I	595	1.70%	0.00%	10.42%	80.50%	G: 7.39%
Indica II	465	31.20%	0.40%	9.46%	53.76%	G: 5.16%
Indica III	913	1.10%	0.10%	14.35%	71.41%	G: 13.03%
Indica Intermediate	786	8.50%	0.00%	13.49%	68.70%	G: 9.29%
Temperate Japonica	767	43.40%	41.60%	14.21%	0.65%	G: 0.13%
Tropical Japonica	504	99.00%	0.20%	0.20%	0.60%	NA
Japonica Intermediate	241	82.60%	8.70%	8.30%	0.41%	NA
VI/Aromatic	96	20.80%	0.00%	48.96%	19.79%	G: 10.42%
Intermediate	90	41.10%	10.00%	11.11%	34.44%	G: 3.33%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0526901536	T -> DEL	N	N	silent_mutation	Average:74.332; most accessible tissue: Minghui63 panicle, score: 84.005	N	N	N	N
vg0526901536	T -> G	LOC_Os05g46420.1	splice_region_variant ; LOW	silent_mutation	Average:74.332; most accessible tissue: Minghui63 panicle, score: 84.005	N	N	N	N
vg0526901536	T -> G	LOC_Os05g46420.1	3_prime_UTR_variant ; 39.0bp to feature; MODIFIER	silent_mutation	Average:74.332; most accessible tissue: Minghui63 panicle, score: 84.005	N	N	N	N
vg0526901536	T -> G	LOC_Os05g46430.1	downstream_gene_variant ; 447.0bp to feature; MODIFIER	silent_mutation	Average:74.332; most accessible tissue: Minghui63 panicle, score: 84.005	N	N	N	N
vg0526901536	T -> G	LOC_Os05g46430.2	downstream_gene_variant ; 447.0bp to feature; MODIFIER	silent_mutation	Average:74.332; most accessible tissue: Minghui63 panicle, score: 84.005	N	N	N	N
vg0526901536	T -> C	LOC_Os05g46420.1	splice_region_variant ; LOW	silent_mutation	Average:74.332; most accessible tissue: Minghui63 panicle, score: 84.005	N	N	N	N
vg0526901536	T -> C	LOC_Os05g46420.1	3_prime_UTR_variant ; 39.0bp to feature; MODIFIER	silent_mutation	Average:74.332; most accessible tissue: Minghui63 panicle, score: 84.005	N	N	N	N
vg0526901536	T -> C	LOC_Os05g46430.1	downstream_gene_variant ; 447.0bp to feature; MODIFIER	silent_mutation	Average:74.332; most accessible tissue: Minghui63 panicle, score: 84.005	N	N	N	N
vg0526901536	T -> C	LOC_Os05g46430.2	downstream_gene_variant ; 447.0bp to feature; MODIFIER	silent_mutation	Average:74.332; most accessible tissue: Minghui63 panicle, score: 84.005	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0526901536	2.92E-06	NA	mr1013	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536	9.37E-06	4.78E-09	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536	1.15E-06	1.98E-14	mr1031	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536	NA	8.61E-10	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536	NA	9.94E-07	mr1034	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536	NA	3.00E-08	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536	NA	6.04E-06	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536	2.38E-07	2.58E-15	mr1056	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536	7.67E-06	5.12E-10	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536	NA	7.44E-07	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536	NA	9.54E-06	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536	NA	6.73E-08	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536	NA	1.58E-06	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536	NA	1.08E-06	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536	NA	6.34E-07	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536	NA	3.46E-07	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536	NA	3.12E-07	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536	NA	4.49E-06	mr1928	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536	NA	3.21E-09	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536	NA	2.87E-10	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536	NA	8.40E-07	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251