\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0526901536:

Variant ID: vg0526901536 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 26901536
Reference Allele: TAlternative Allele: C,G
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


CGCTTGTCAGAAACTCACAATGCAAAATCATCTCCCTCACGGGTTCACATTCTCTACCATAATAACATTATCATTGCAAATACTTCAAAATATTTGACAC[T/C,G]
ATTGACTTTTTAGTACGTGTTTGACTATTCGTCTTATTCAAAAAAATTTAAGTAATTATTTATTCTTTTTATATCATTTGATTCGTTGTTAAATATAATT

Reverse complement sequence

AATTATATTTAACAACGAATCAAATGATATAAAAAGAATAAATAATTACTTAAATTTTTTTGAATAAGACGAATAGTCAAACACGTACTAAAAAGTCAAT[A/G,C]
GTGTCAAATATTTTGAAGTATTTGCAATGATAATGTTATTATGGTAGAGAATGTGAACCCGTGAGGGAGATGATTTTGCATTGTGAGTTTCTGACAAGCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.90% 7.50% 12.42% 45.34% G: 5.90%
All Indica  2759 8.40% 0.10% 12.43% 69.63% G: 9.42%
All Japonica  1512 68.20% 22.60% 8.60% 0.60% G: 0.07%
Aus  269 16.40% 0.00% 21.19% 60.59% G: 1.86%
Indica I  595 1.70% 0.00% 10.42% 80.50% G: 7.39%
Indica II  465 31.20% 0.40% 9.46% 53.76% G: 5.16%
Indica III  913 1.10% 0.10% 14.35% 71.41% G: 13.03%
Indica Intermediate  786 8.50% 0.00% 13.49% 68.70% G: 9.29%
Temperate Japonica  767 43.40% 41.60% 14.21% 0.65% G: 0.13%
Tropical Japonica  504 99.00% 0.20% 0.20% 0.60% NA
Japonica Intermediate  241 82.60% 8.70% 8.30% 0.41% NA
VI/Aromatic  96 20.80% 0.00% 48.96% 19.79% G: 10.42%
Intermediate  90 41.10% 10.00% 11.11% 34.44% G: 3.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0526901536 T -> DEL N N silent_mutation Average:74.332; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N
vg0526901536 T -> G LOC_Os05g46420.1 splice_region_variant ; LOW silent_mutation Average:74.332; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N
vg0526901536 T -> G LOC_Os05g46420.1 3_prime_UTR_variant ; 39.0bp to feature; MODIFIER silent_mutation Average:74.332; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N
vg0526901536 T -> G LOC_Os05g46430.1 downstream_gene_variant ; 447.0bp to feature; MODIFIER silent_mutation Average:74.332; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N
vg0526901536 T -> G LOC_Os05g46430.2 downstream_gene_variant ; 447.0bp to feature; MODIFIER silent_mutation Average:74.332; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N
vg0526901536 T -> C LOC_Os05g46420.1 splice_region_variant ; LOW silent_mutation Average:74.332; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N
vg0526901536 T -> C LOC_Os05g46420.1 3_prime_UTR_variant ; 39.0bp to feature; MODIFIER silent_mutation Average:74.332; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N
vg0526901536 T -> C LOC_Os05g46430.1 downstream_gene_variant ; 447.0bp to feature; MODIFIER silent_mutation Average:74.332; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N
vg0526901536 T -> C LOC_Os05g46430.2 downstream_gene_variant ; 447.0bp to feature; MODIFIER silent_mutation Average:74.332; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0526901536 2.92E-06 NA mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536 9.37E-06 4.78E-09 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536 1.15E-06 1.98E-14 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536 NA 8.61E-10 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536 NA 9.94E-07 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536 NA 3.00E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536 NA 6.04E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536 2.38E-07 2.58E-15 mr1056 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536 7.67E-06 5.12E-10 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536 NA 7.44E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536 NA 9.54E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536 NA 6.73E-08 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536 NA 1.58E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536 NA 1.08E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536 NA 6.34E-07 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536 NA 3.46E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536 NA 3.12E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536 NA 4.49E-06 mr1928 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536 NA 3.21E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536 NA 2.87E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526901536 NA 8.40E-07 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251