Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0526731344:

Variant ID: vg0526731344 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 26731344
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.85, C: 0.15, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

GAAAAAGGGTATGCATGCATGTAGTACTAGTCCGATGTAGTAGACTCAACGTCTTCTCCATATTCAGGCGTCGCTAGTTAAGGCAAAAACGAGAGGCCTC[T/C]
CCAAATAGATTTTACGTTAAAAATAACTGTTAATACGGTATTACTGGACAGTAATTCTATTTATAAAGCATACATGCTCAAATGAAATGAAATTAAGCAG

Reverse complement sequence

CTGCTTAATTTCATTTCATTTGAGCATGTATGCTTTATAAATAGAATTACTGTCCAGTAATACCGTATTAACAGTTATTTTTAACGTAAAATCTATTTGG[A/G]
GAGGCCTCTCGTTTTTGCCTTAACTAGCGACGCCTGAATATGGAGAAGACGTTGAGTCTACTACATCGGACTAGTACTACATGCATGCATACCCTTTTTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.50%	5.00%	2.75%	51.76%	NA
All Indica	2759	11.60%	1.20%	1.81%	85.39%	NA
All Japonica	1512	99.10%	0.00%	0.07%	0.86%	NA
Aus	269	8.20%	71.70%	12.27%	7.81%	NA
Indica I	595	2.00%	0.00%	1.01%	96.97%	NA
Indica II	465	37.60%	0.60%	1.08%	60.65%	NA
Indica III	913	3.80%	1.00%	2.74%	92.44%	NA
Indica Intermediate	786	12.50%	2.70%	1.78%	83.08%	NA
Temperate Japonica	767	99.00%	0.00%	0.00%	1.04%	NA
Tropical Japonica	504	99.00%	0.00%	0.00%	0.99%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	21.90%	6.20%	43.75%	28.12%	NA
Intermediate	90	61.10%	2.20%	4.44%	32.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0526731344	T -> DEL	N	N	silent_mutation	Average:55.5; most accessible tissue: Zhenshan97 root, score: 76.035	N	N	N	N
vg0526731344	T -> C	LOC_Os05g46090.1	downstream_gene_variant ; 1064.0bp to feature; MODIFIER	silent_mutation	Average:55.5; most accessible tissue: Zhenshan97 root, score: 76.035	N	N	N	N
vg0526731344	T -> C	LOC_Os05g46070-LOC_Os05g46090	intergenic_region ; MODIFIER	silent_mutation	Average:55.5; most accessible tissue: Zhenshan97 root, score: 76.035	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0526731344	NA	8.80E-33	mr1098	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	NA	9.06E-27	mr1099	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	NA	7.61E-30	mr1101	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	NA	2.72E-19	mr1113	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	1.03E-06	4.19E-25	mr1114	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	5.22E-08	8.72E-23	mr1116	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	NA	6.28E-25	mr1117	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	NA	5.41E-21	mr1119	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	NA	8.72E-22	mr1120	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	3.09E-06	2.50E-32	mr1123	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	NA	1.70E-22	mr1150	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	NA	2.21E-20	mr1240	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	NA	6.28E-22	mr1242	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	NA	4.39E-27	mr1247	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	NA	7.38E-19	mr1496	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	NA	9.52E-23	mr1589	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	NA	3.75E-27	mr1858	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	NA	3.50E-27	mr1859	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	NA	7.25E-25	mr1868	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	NA	8.05E-17	mr1911	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	NA	3.44E-12	mr1918	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	NA	1.45E-21	mr1936	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	NA	9.87E-19	mr1961	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	NA	3.77E-32	mr1098_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	NA	8.07E-26	mr1099_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	NA	7.55E-24	mr1113_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	NA	8.67E-23	mr1114_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	1.67E-06	1.95E-26	mr1117_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	2.42E-06	1.05E-24	mr1119_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	8.25E-06	1.27E-29	mr1120_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	2.06E-07	6.46E-34	mr1123_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	NA	3.90E-22	mr1240_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	3.93E-07	9.37E-25	mr1242_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	3.85E-07	2.58E-33	mr1247_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	NA	4.28E-06	mr1344_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	1.93E-07	3.54E-20	mr1496_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	NA	2.13E-12	mr1918_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	NA	8.15E-19	mr1936_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526731344	NA	5.94E-18	mr1961_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251