Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0526662708:

Variant ID: vg0526662708 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 26662708
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.07, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


AAACCAAAGAAAAGGAAGAGAGAAACGACTGCTAGACGCAACTCCAATTAGCAGGAGGGGGCAAGGCCACACTACCCTTCTAAAAAAACCCCAAAAAAAA[G/A]
TGACACCAGCTAACGACCAGAGATGGCCCTCAGAAAATATGGACTCTAAGACCACAGAGACCGAAGAGAGAACAAAGTCGAAAACCCTAGTATCCTATTC

Reverse complement sequence

GAATAGGATACTAGGGTTTTCGACTTTGTTCTCTCTTCGGTCTCTGTGGTCTTAGAGTCCATATTTTCTGAGGGCCATCTCTGGTCGTTAGCTGGTGTCA[C/T]
TTTTTTTTGGGGTTTTTTTAGAAGGGTAGTGTGGCCTTGCCCCCTCCTGCTAATTGGAGTTGCGTCTAGCAGTCGTTTCTCTCTTCCTTTTCTTTGGTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.00% 45.90% 0.08% 0.00% NA
All Indica  2759 89.50% 10.40% 0.14% 0.00% NA
All Japonica  1512 1.00% 99.00% 0.00% 0.00% NA
Aus  269 4.80% 95.20% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 64.50% 35.30% 0.22% 0.00% NA
Indica III  913 97.00% 3.00% 0.00% 0.00% NA
Indica Intermediate  786 87.70% 12.00% 0.38% 0.00% NA
Temperate Japonica  767 1.30% 98.70% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 99.00% 0.00% 0.00% NA
Japonica Intermediate  241 0.00% 100.00% 0.00% 0.00% NA
VI/Aromatic  96 26.00% 74.00% 0.00% 0.00% NA
Intermediate  90 32.20% 67.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0526662708 G -> A LOC_Os05g45990.1 upstream_gene_variant ; 1044.0bp to feature; MODIFIER silent_mutation Average:61.692; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg0526662708 G -> A LOC_Os05g46000.1 upstream_gene_variant ; 1909.0bp to feature; MODIFIER silent_mutation Average:61.692; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg0526662708 G -> A LOC_Os05g45990-LOC_Os05g46000 intergenic_region ; MODIFIER silent_mutation Average:61.692; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0526662708 NA 7.58E-06 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526662708 NA 2.18E-17 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526662708 NA 4.07E-08 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526662708 NA 4.50E-08 mr1896 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526662708 NA 1.42E-08 mr1903 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526662708 NA 5.10E-09 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526662708 NA 1.01E-12 mr1938 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526662708 NA 9.90E-56 mr1109_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526662708 8.52E-06 NA mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526662708 2.80E-06 NA mr1114_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526662708 2.67E-07 NA mr1242_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526662708 NA 2.60E-25 mr1253_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526662708 NA 3.42E-06 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526662708 NA 1.65E-11 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526662708 NA 8.35E-11 mr1352_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526662708 NA 3.85E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526662708 NA 2.61E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526662708 NA 4.71E-12 mr1546_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526662708 NA 2.35E-35 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526662708 NA 6.31E-10 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526662708 NA 5.88E-06 mr1682_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526662708 NA 1.22E-08 mr1828_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526662708 NA 2.49E-08 mr1907_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526662708 NA 1.84E-08 mr1934_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526662708 NA 5.42E-15 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526662708 NA 6.96E-06 mr1954_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251