\
| Variant ID: vg0526462498 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 26462498 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.61, A: 0.39, others allele: 0.00, population size: 85. )
ATGTTAACAATATATATAAGCTGTATTTAGTTCACACTGAAGTTTGGAAGTTTGGTTGAAATTGGTACGATGTGATAGAAAAGTTGTGTGTGTATAAAAA[A/G]
TTTGATGTGATGGAAAGTTGGAAGTTTGGAAAAAAAACTTTGGAACTAAACAGGGCCATAGTTTGATGTTATTTGGATTGCAATACTGTCTGTCATCAGG
CCTGATGACAGACAGTATTGCAATCCAAATAACATCAAACTATGGCCCTGTTTAGTTCCAAAGTTTTTTTTCCAAACTTCCAACTTTCCATCACATCAAA[T/C]
TTTTTATACACACACAACTTTTCTATCACATCGTACCAATTTCAACCAAACTTCCAAACTTCAGTGTGAACTAAATACAGCTTATATATATTGTTAACAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.10% | 34.80% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 92.40% | 7.50% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 9.80% | 90.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.50% | 0.34% | 0.00% | NA |
| Indica II | 465 | 68.40% | 31.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.10% | 6.70% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 3.80% | 96.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 10.30% | 89.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 27.80% | 72.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 78.10% | 21.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 46.70% | 53.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0526462498 | A -> G | LOC_Os05g45650.1 | upstream_gene_variant ; 2745.0bp to feature; MODIFIER | silent_mutation | Average:53.134; most accessible tissue: Callus, score: 81.459 | N | N | N | N |
| vg0526462498 | A -> G | LOC_Os05g45660.2 | upstream_gene_variant ; 1584.0bp to feature; MODIFIER | silent_mutation | Average:53.134; most accessible tissue: Callus, score: 81.459 | N | N | N | N |
| vg0526462498 | A -> G | LOC_Os05g45650-LOC_Os05g45660 | intergenic_region ; MODIFIER | silent_mutation | Average:53.134; most accessible tissue: Callus, score: 81.459 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0526462498 | NA | 5.98E-15 | mr1059 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526462498 | NA | 2.21E-14 | mr1535 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526462498 | NA | 2.23E-13 | mr1726 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526462498 | NA | 6.81E-08 | mr1030_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526462498 | NA | 2.60E-07 | mr1115_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526462498 | NA | 6.92E-06 | mr1173_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526462498 | NA | 5.44E-21 | mr1195_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526462498 | NA | 5.10E-11 | mr1195_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526462498 | NA | 5.03E-08 | mr1299_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526462498 | NA | 4.82E-06 | mr1332_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526462498 | NA | 6.00E-08 | mr1358_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526462498 | NA | 1.82E-06 | mr1391_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526462498 | NA | 6.63E-06 | mr1403_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526462498 | NA | 3.17E-07 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526462498 | NA | 1.38E-07 | mr1482_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526462498 | NA | 1.14E-09 | mr1546_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526462498 | NA | 3.02E-07 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526462498 | NA | 3.62E-06 | mr1562_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526462498 | NA | 3.95E-06 | mr1562_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526462498 | NA | 2.08E-07 | mr1580_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526462498 | NA | 3.79E-06 | mr1611_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526462498 | NA | 6.67E-06 | mr1617_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526462498 | NA | 2.54E-06 | mr1624_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526462498 | NA | 1.10E-09 | mr1705_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526462498 | NA | 4.47E-08 | mr1825_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526462498 | NA | 4.24E-09 | mr1828_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526462498 | NA | 1.75E-07 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526462498 | 4.61E-06 | 4.61E-06 | mr1884_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526462498 | NA | 2.01E-14 | mr1938_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526462498 | NA | 6.82E-07 | mr1938_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |