\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0526356726:

Variant ID: vg0526356726 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 26356726
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.71, G: 0.29, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTATGGCCAGATCGGCCACGCACAAATCACAGCCAGTTACCATAAGGCTGTGTTTAGTTCAGCGCAAAGTTTAAATTTTAGTTGAAATTAGAGATGAT[A/G]
TGACTGAAAAGTTATATATGTATGACAGGTTGATGTGATAAAAAAGGACTAAAGTTTGGATCTAAACTTGAATCTAAACACAGCCTAACTCCCCTGGGAC

Reverse complement sequence

GTCCCAGGGGAGTTAGGCTGTGTTTAGATTCAAGTTTAGATCCAAACTTTAGTCCTTTTTTATCACATCAACCTGTCATACATATATAACTTTTCAGTCA[T/C]
ATCATCTCTAATTTCAACTAAAATTTAAACTTTGCGCTGAACTAAACACAGCCTTATGGTAACTGGCTGTGATTTGTGCGTGGCCGATCTGGCCATAAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.80% 41.10% 0.99% 0.17% NA
All Indica  2759 85.00% 13.30% 1.49% 0.25% NA
All Japonica  1512 0.90% 98.90% 0.13% 0.07% NA
Aus  269 97.00% 3.00% 0.00% 0.00% NA
Indica I  595 72.30% 23.20% 4.20% 0.34% NA
Indica II  465 67.70% 30.30% 1.51% 0.43% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 87.90% 10.60% 1.15% 0.38% NA
Temperate Japonica  767 1.20% 98.80% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 99.00% 0.40% 0.00% NA
Japonica Intermediate  241 0.80% 98.80% 0.00% 0.41% NA
VI/Aromatic  96 75.00% 24.00% 1.04% 0.00% NA
Intermediate  90 43.30% 53.30% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0526356726 A -> DEL N N silent_mutation Average:91.298; most accessible tissue: Minghui63 panicle, score: 99.188 N N N N
vg0526356726 A -> G LOC_Os05g45430.1 3_prime_UTR_variant ; 349.0bp to feature; MODIFIER silent_mutation Average:91.298; most accessible tissue: Minghui63 panicle, score: 99.188 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0526356726 A G 0.03 0.03 0.0 0.07 0.05 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0526356726 1.48E-08 NA mr1038 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526356726 1.06E-07 9.00E-10 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526356726 NA 1.71E-44 mr1141 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526356726 NA 5.95E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526356726 5.18E-07 NA mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526356726 8.68E-06 5.69E-08 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526356726 NA 9.69E-07 mr1743 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526356726 NA 9.60E-08 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526356726 NA 3.55E-54 mr1141_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526356726 NA 2.09E-09 mr1141_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526356726 NA 1.54E-18 mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526356726 NA 1.47E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526356726 NA 8.23E-07 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526356726 NA 1.49E-10 mr1546_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526356726 NA 6.57E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526356726 NA 7.70E-06 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526356726 NA 1.14E-07 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526356726 NA 1.07E-06 mr1654_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526356726 NA 1.64E-07 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526356726 NA 7.70E-08 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251