| Variant ID: vg0526324545 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 26324545 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.63, T: 0.37, others allele: 0.00, population size: 84. )
TAATTAATCCATGATTAGCCTATGTGATGCTACAGTAAACATTATCTAATTATGGATTAATTAGGCTTAAAAAAATTTATCTCGCAAATTAGCTTTCATT[T/C]
ATGTAATTAGTTTTGTAAGTAGTCTATATTTAATACTCTAAATTAGTGTCTAAATACATAGACTAAAGTTAAGTCCCTGGATCCAAACACCACCATAGTA
TACTATGGTGGTGTTTGGATCCAGGGACTTAACTTTAGTCTATGTATTTAGACACTAATTTAGAGTATTAAATATAGACTACTTACAAAACTAATTACAT[A/G]
AATGAAAGCTAATTTGCGAGATAAATTTTTTTAAGCCTAATTAATCCATAATTAGATAATGTTTACTGTAGCATCACATAGGCTAATCATGGATTAATTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.80% | 17.80% | 0.42% | 0.00% | NA |
| All Indica | 2759 | 93.40% | 6.30% | 0.36% | 0.00% | NA |
| All Japonica | 1512 | 58.10% | 41.30% | 0.53% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 72.00% | 26.90% | 1.08% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.00% | 5.60% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 91.10% | 8.70% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 6.20% | 93.10% | 0.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 61.80% | 36.90% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 88.50% | 11.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 31.10% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0526324545 | T -> C | LOC_Os05g45380.1 | upstream_gene_variant ; 4074.0bp to feature; MODIFIER | silent_mutation | Average:44.463; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg0526324545 | T -> C | LOC_Os05g45370.1 | intron_variant ; MODIFIER | silent_mutation | Average:44.463; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0526324545 | NA | 6.54E-18 | mr1016 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526324545 | NA | 1.79E-13 | mr1017 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526324545 | NA | 2.15E-19 | mr1022 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526324545 | NA | 1.13E-12 | mr1023 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526324545 | NA | 2.49E-06 | mr1044 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526324545 | NA | 2.12E-15 | mr1055 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526324545 | NA | 7.41E-19 | mr1079 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526324545 | NA | 8.84E-14 | mr1132 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526324545 | NA | 8.57E-15 | mr1142 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526324545 | NA | 1.16E-18 | mr1178 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/