\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0526279747:

Variant ID: vg0526279747 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 26279747
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.87, C: 0.14, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


TGCAAACCATGGTACAAACTGCCAACGGATGAACAAGGAATATATGAGTCACCTACTTCTACTAATTTACAGATCCTTGTGATCCTAGAGCTCGACAGAC[C/T]
ACTAATACATCGTGTTGCTCAGGATCTAGTTCACTGTACTTGGTCTGATAATTTTAGTCAAGTTGCAACCAAGGAGAGATCTCAGCTTCTGCTTGCTCCT

Reverse complement sequence

AGGAGCAAGCAGAAGCTGAGATCTCTCCTTGGTTGCAACTTGACTAAAATTATCAGACCAAGTACAGTGAACTAGATCCTGAGCAACACGATGTATTAGT[G/A]
GTCTGTCGAGCTCTAGGATCACAAGGATCTGTAAATTAGTAGAAGTAGGTGACTCATATATTCCTTGTTCATCCGTTGGCAGTTTGTACCATGGTTTGCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.10% 37.50% 0.15% 0.21% NA
All Indica  2759 92.00% 7.50% 0.18% 0.36% NA
All Japonica  1512 1.00% 99.00% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 99.70% 0.20% 0.00% 0.17% NA
Indica II  465 69.20% 29.20% 0.43% 1.08% NA
Indica III  913 96.90% 2.70% 0.11% 0.22% NA
Indica Intermediate  786 93.90% 5.60% 0.25% 0.25% NA
Temperate Japonica  767 1.30% 98.70% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 99.20% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 77.10% 22.90% 0.00% 0.00% NA
Intermediate  90 48.90% 48.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0526279747 C -> T LOC_Os05g45280.1 3_prime_UTR_variant ; 82.0bp to feature; MODIFIER silent_mutation Average:79.887; most accessible tissue: Callus, score: 94.981 N N N N
vg0526279747 C -> T LOC_Os05g45270.1 downstream_gene_variant ; 336.0bp to feature; MODIFIER silent_mutation Average:79.887; most accessible tissue: Callus, score: 94.981 N N N N
vg0526279747 C -> DEL N N silent_mutation Average:79.887; most accessible tissue: Callus, score: 94.981 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0526279747 NA 1.73E-44 mr1016 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 5.59E-12 mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 1.46E-29 mr1022 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 4.70E-13 mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 5.53E-16 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 1.35E-38 mr1105 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 1.27E-43 mr1141 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 1.17E-15 mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 2.08E-16 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 9.32E-12 mr1178 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 3.72E-10 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 3.00E-18 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 2.96E-15 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 2.71E-28 mr1546 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 1.45E-06 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 6.81E-16 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 2.12E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 5.30E-15 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 5.12E-25 mr1903 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 2.03E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 7.83E-74 mr1934 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 4.59E-15 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 2.59E-15 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 2.80E-17 mr1995 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 3.12E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 8.16E-06 4.41E-34 mr1105_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 1.31E-12 mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 8.83E-56 mr1141_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 3.85E-22 mr1175_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 6.04E-06 mr1193_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 1.24E-21 mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 1.22E-10 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 3.70E-09 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 8.58E-10 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 1.34E-12 mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 1.37E-08 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 6.28E-09 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 5.24E-51 mr1546_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 5.45E-12 mr1546_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 1.18E-15 mr1587_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 2.02E-58 mr1599_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 1.33E-07 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 1.02E-06 mr1654_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 8.32E-06 mr1682_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 2.64E-32 mr1780_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 2.39E-08 7.17E-78 mr1828_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 2.41E-06 7.37E-12 mr1828_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 3.79E-10 mr1907_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 2.96E-84 mr1934_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 4.63E-09 mr1934_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 NA 1.31E-14 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 8.22E-06 3.24E-41 mr1944_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526279747 1.25E-06 NA mr1944_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251