\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0526207590:

Variant ID: vg0526207590 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 26207590
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTATGTCTCCAAGATGAAGGCCCTCGCTGATGAGATGACGGCTGCCGGCAAGATCGTTGATGACGATGATCTCATCTCCTACATCATCGCCGGCCTCGAC[G/A,T]
ACACGTATGAACCTGTCATCTCCACCATCGTTGGCAAGGACACCATGACGCTGGGAGAAGCCTACTCTCAGCTGCTCAGCTTTGAGCAGCGTCTCGCGCT

Reverse complement sequence

AGCGCGAGACGCTGCTCAAAGCTGAGCAGCTGAGAGTAGGCTTCTCCCAGCGTCATGGTGTCCTTGCCAACGATGGTGGAGATGACAGGTTCATACGTGT[C/T,A]
GTCGAGGCCGGCGATGATGTAGGAGATGAGATCATCGTCATCAACGATCTTGCCGGCAGCCGTCATCTCATCAGCGAGGGCCTTCATCTTGGAGACATAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.80% 3.00% 1.84% 25.16% A: 0.17%
All Indica  2759 61.80% 4.90% 2.46% 30.74% A: 0.04%
All Japonica  1512 96.80% 0.10% 0.13% 2.98% NA
Aus  269 11.20% 0.40% 2.60% 85.87% NA
Indica I  595 69.40% 1.20% 5.71% 23.70% NA
Indica II  465 91.20% 0.90% 0.22% 7.74% NA
Indica III  913 41.80% 8.90% 2.08% 47.10% A: 0.11%
Indica Intermediate  786 62.00% 5.60% 1.78% 30.66% NA
Temperate Japonica  767 99.50% 0.00% 0.00% 0.52% NA
Tropical Japonica  504 92.10% 0.20% 0.40% 7.34% NA
Japonica Intermediate  241 98.30% 0.00% 0.00% 1.66% NA
VI/Aromatic  96 34.40% 3.10% 7.29% 47.92% A: 7.29%
Intermediate  90 73.30% 2.20% 3.33% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0526207590 G -> T LOC_Os05g45130.1 missense_variant ; p.Asp181Tyr; MODERATE nonsynonymous_codon ; D181Y Average:65.255; most accessible tissue: Zhenshan97 young leaf, score: 83.623 unknown unknown TOLERATED 1.00
vg0526207590 G -> DEL LOC_Os05g45130.1 N frameshift_variant Average:65.255; most accessible tissue: Zhenshan97 young leaf, score: 83.623 N N N N
vg0526207590 G -> A LOC_Os05g45130.1 missense_variant ; p.Asp181Asn; MODERATE nonsynonymous_codon ; D181N Average:65.255; most accessible tissue: Zhenshan97 young leaf, score: 83.623 unknown unknown TOLERATED 0.40

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0526207590 1.98E-08 2.87E-10 mr1238 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526207590 NA 2.16E-06 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526207590 NA 1.71E-07 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526207590 6.10E-06 6.10E-06 mr1900 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526207590 NA 9.40E-08 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526207590 NA 3.06E-06 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526207590 NA 5.59E-09 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251