\
| Variant ID: vg0526207590 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 26207590 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTATGTCTCCAAGATGAAGGCCCTCGCTGATGAGATGACGGCTGCCGGCAAGATCGTTGATGACGATGATCTCATCTCCTACATCATCGCCGGCCTCGAC[G/A,T]
ACACGTATGAACCTGTCATCTCCACCATCGTTGGCAAGGACACCATGACGCTGGGAGAAGCCTACTCTCAGCTGCTCAGCTTTGAGCAGCGTCTCGCGCT
AGCGCGAGACGCTGCTCAAAGCTGAGCAGCTGAGAGTAGGCTTCTCCCAGCGTCATGGTGTCCTTGCCAACGATGGTGGAGATGACAGGTTCATACGTGT[C/T,A]
GTCGAGGCCGGCGATGATGTAGGAGATGAGATCATCGTCATCAACGATCTTGCCGGCAGCCGTCATCTCATCAGCGAGGGCCTTCATCTTGGAGACATAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.80% | 3.00% | 1.84% | 25.16% | A: 0.17% |
| All Indica | 2759 | 61.80% | 4.90% | 2.46% | 30.74% | A: 0.04% |
| All Japonica | 1512 | 96.80% | 0.10% | 0.13% | 2.98% | NA |
| Aus | 269 | 11.20% | 0.40% | 2.60% | 85.87% | NA |
| Indica I | 595 | 69.40% | 1.20% | 5.71% | 23.70% | NA |
| Indica II | 465 | 91.20% | 0.90% | 0.22% | 7.74% | NA |
| Indica III | 913 | 41.80% | 8.90% | 2.08% | 47.10% | A: 0.11% |
| Indica Intermediate | 786 | 62.00% | 5.60% | 1.78% | 30.66% | NA |
| Temperate Japonica | 767 | 99.50% | 0.00% | 0.00% | 0.52% | NA |
| Tropical Japonica | 504 | 92.10% | 0.20% | 0.40% | 7.34% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.00% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 34.40% | 3.10% | 7.29% | 47.92% | A: 7.29% |
| Intermediate | 90 | 73.30% | 2.20% | 3.33% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0526207590 | G -> T | LOC_Os05g45130.1 | missense_variant ; p.Asp181Tyr; MODERATE | nonsynonymous_codon ; D181Y | Average:65.255; most accessible tissue: Zhenshan97 young leaf, score: 83.623 | unknown | unknown | TOLERATED | 1.00 |
| vg0526207590 | G -> DEL | LOC_Os05g45130.1 | N | frameshift_variant | Average:65.255; most accessible tissue: Zhenshan97 young leaf, score: 83.623 | N | N | N | N |
| vg0526207590 | G -> A | LOC_Os05g45130.1 | missense_variant ; p.Asp181Asn; MODERATE | nonsynonymous_codon ; D181N | Average:65.255; most accessible tissue: Zhenshan97 young leaf, score: 83.623 | unknown | unknown | TOLERATED | 0.40 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0526207590 | 1.98E-08 | 2.87E-10 | mr1238 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526207590 | NA | 2.16E-06 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526207590 | NA | 1.71E-07 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526207590 | 6.10E-06 | 6.10E-06 | mr1900 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526207590 | NA | 9.40E-08 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526207590 | NA | 3.06E-06 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526207590 | NA | 5.59E-09 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |