\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0526063526:

Variant ID: vg0526063526 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 26063526
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.80, G: 0.20, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


TAACACACTAGATGGATGAACACAAAGCTCAAGTGGGTGTGAGAGAGGTGCAATGGGTGTATGCAATTGAATTGGGTGCCAAGAGAGCCCCCTTGCTGCT[A/G]
GAAGGGGAGTATTTATACTCCCACCAACCAAAACTAGCCGTTGGGGGCGAAATCTTTATGCTCTGCCGGTCTGACCGGAGGTATGTGGCCGGTCAGACCG

Reverse complement sequence

CGGTCTGACCGGCCACATACCTCCGGTCAGACCGGCAGAGCATAAAGATTTCGCCCCCAACGGCTAGTTTTGGTTGGTGGGAGTATAAATACTCCCCTTC[T/C]
AGCAGCAAGGGGGCTCTCTTGGCACCCAATTCAATTGCATACACCCATTGCACCTCTCTCACACCCACTTGAGCTTTGTGTTCATCCATCTAGTGTGTTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.80% 40.10% 2.07% 0.00% NA
All Indica  2759 87.50% 9.00% 3.55% 0.00% NA
All Japonica  1512 0.80% 99.20% 0.00% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 90.30% 2.20% 7.56% 0.00% NA
Indica II  465 75.70% 21.70% 2.58% 0.00% NA
Indica III  913 90.80% 7.70% 1.53% 0.00% NA
Indica Intermediate  786 88.40% 8.10% 3.44% 0.00% NA
Temperate Japonica  767 1.30% 98.70% 0.00% 0.00% NA
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 0.00% 100.00% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 44.40% 55.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0526063526 A -> G LOC_Os05g44820.1 upstream_gene_variant ; 4934.0bp to feature; MODIFIER silent_mutation Average:38.26; most accessible tissue: Minghui63 young leaf, score: 53.016 N N N N
vg0526063526 A -> G LOC_Os05g44840.1 downstream_gene_variant ; 1344.0bp to feature; MODIFIER silent_mutation Average:38.26; most accessible tissue: Minghui63 young leaf, score: 53.016 N N N N
vg0526063526 A -> G LOC_Os05g44850.1 downstream_gene_variant ; 4386.0bp to feature; MODIFIER silent_mutation Average:38.26; most accessible tissue: Minghui63 young leaf, score: 53.016 N N N N
vg0526063526 A -> G LOC_Os05g44830.1 intron_variant ; MODIFIER silent_mutation Average:38.26; most accessible tissue: Minghui63 young leaf, score: 53.016 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0526063526 2.82E-06 2.81E-06 mr1492 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526063526 NA 6.23E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526063526 NA 3.38E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526063526 NA 8.90E-18 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526063526 NA 7.15E-20 mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526063526 NA 2.42E-17 mr1281_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526063526 NA 1.78E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526063526 NA 1.41E-07 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526063526 NA 2.66E-13 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526063526 NA 2.06E-08 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526063526 NA 4.81E-14 mr1790_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526063526 NA 8.12E-08 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526063526 7.43E-06 9.05E-12 mr1828_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526063526 NA 1.89E-08 mr1907_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251