\
| Variant ID: vg0526063526 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 26063526 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.80, G: 0.20, others allele: 0.00, population size: 85. )
TAACACACTAGATGGATGAACACAAAGCTCAAGTGGGTGTGAGAGAGGTGCAATGGGTGTATGCAATTGAATTGGGTGCCAAGAGAGCCCCCTTGCTGCT[A/G]
GAAGGGGAGTATTTATACTCCCACCAACCAAAACTAGCCGTTGGGGGCGAAATCTTTATGCTCTGCCGGTCTGACCGGAGGTATGTGGCCGGTCAGACCG
CGGTCTGACCGGCCACATACCTCCGGTCAGACCGGCAGAGCATAAAGATTTCGCCCCCAACGGCTAGTTTTGGTTGGTGGGAGTATAAATACTCCCCTTC[T/C]
AGCAGCAAGGGGGCTCTCTTGGCACCCAATTCAATTGCATACACCCATTGCACCTCTCTCACACCCACTTGAGCTTTGTGTTCATCCATCTAGTGTGTTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.80% | 40.10% | 2.07% | 0.00% | NA |
| All Indica | 2759 | 87.50% | 9.00% | 3.55% | 0.00% | NA |
| All Japonica | 1512 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 90.30% | 2.20% | 7.56% | 0.00% | NA |
| Indica II | 465 | 75.70% | 21.70% | 2.58% | 0.00% | NA |
| Indica III | 913 | 90.80% | 7.70% | 1.53% | 0.00% | NA |
| Indica Intermediate | 786 | 88.40% | 8.10% | 3.44% | 0.00% | NA |
| Temperate Japonica | 767 | 1.30% | 98.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 3.10% | 96.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 44.40% | 55.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0526063526 | A -> G | LOC_Os05g44820.1 | upstream_gene_variant ; 4934.0bp to feature; MODIFIER | silent_mutation | Average:38.26; most accessible tissue: Minghui63 young leaf, score: 53.016 | N | N | N | N |
| vg0526063526 | A -> G | LOC_Os05g44840.1 | downstream_gene_variant ; 1344.0bp to feature; MODIFIER | silent_mutation | Average:38.26; most accessible tissue: Minghui63 young leaf, score: 53.016 | N | N | N | N |
| vg0526063526 | A -> G | LOC_Os05g44850.1 | downstream_gene_variant ; 4386.0bp to feature; MODIFIER | silent_mutation | Average:38.26; most accessible tissue: Minghui63 young leaf, score: 53.016 | N | N | N | N |
| vg0526063526 | A -> G | LOC_Os05g44830.1 | intron_variant ; MODIFIER | silent_mutation | Average:38.26; most accessible tissue: Minghui63 young leaf, score: 53.016 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0526063526 | 2.82E-06 | 2.81E-06 | mr1492 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526063526 | NA | 6.23E-07 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526063526 | NA | 3.38E-07 | mr1030_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526063526 | NA | 8.90E-18 | mr1162_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526063526 | NA | 7.15E-20 | mr1195_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526063526 | NA | 2.42E-17 | mr1281_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526063526 | NA | 1.78E-06 | mr1358_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526063526 | NA | 1.41E-07 | mr1654_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526063526 | NA | 2.66E-13 | mr1713_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526063526 | NA | 2.06E-08 | mr1749_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526063526 | NA | 4.81E-14 | mr1790_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526063526 | NA | 8.12E-08 | mr1821_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526063526 | 7.43E-06 | 9.05E-12 | mr1828_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526063526 | NA | 1.89E-08 | mr1907_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |