\
| Variant ID: vg0526045307 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 26045307 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 117. )
TTGTAGTCTTCCTTACACTCTTCTAAATTCCTTTTAGTCAACTTCAATCTGAATATCAATATTCTTCCACATATTTGACGTATTGTATCAGGAATCATAT[C/T]
AATTTGTCCATTCTGTTCCTCCAGCATGGTGGACACAGACTTATGACCAAATATTCTTTCTGCTTCCTCATTAAATATTGTACATGTCGTCCTAGTAGTG
CACTACTAGGACGACATGTACAATATTTAATGAGGAAGCAGAAAGAATATTTGGTCATAAGTCTGTGTCCACCATGCTGGAGGAACAGAATGGACAAATT[G/A]
ATATGATTCCTGATACAATACGTCAAATATGTGGAAGAATATTGATATTCAGATTGAAGTTGACTAAAAGGAATTTAGAAGAGTGTAAGGAAGACTACAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.30% | 3.90% | 2.31% | 39.53% | NA |
| All Indica | 2759 | 30.70% | 6.70% | 3.37% | 59.26% | NA |
| All Japonica | 1512 | 99.30% | 0.00% | 0.00% | 0.66% | NA |
| Aus | 269 | 21.90% | 0.00% | 5.20% | 72.86% | NA |
| Indica I | 595 | 27.10% | 23.20% | 5.04% | 44.71% | NA |
| Indica II | 465 | 29.50% | 0.40% | 2.80% | 67.31% | NA |
| Indica III | 913 | 31.90% | 0.30% | 3.29% | 64.51% | NA |
| Indica Intermediate | 786 | 32.70% | 5.30% | 2.54% | 59.41% | NA |
| Temperate Japonica | 767 | 98.80% | 0.00% | 0.00% | 1.17% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 0.00% | 2.22% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0526045307 | C -> T | LOC_Os05g44792.1 | missense_variant ; p.Asp737Asn; MODERATE | nonsynonymous_codon ; D737N | Average:7.598; most accessible tissue: Zhenshan97 root, score: 15.132 | unknown | unknown | DELETERIOUS | 0.00 |
| vg0526045307 | C -> DEL | LOC_Os05g44792.1 | N | frameshift_variant | Average:7.598; most accessible tissue: Zhenshan97 root, score: 15.132 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0526045307 | NA | 3.46E-06 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526045307 | NA | 5.19E-07 | mr1280 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526045307 | NA | 9.60E-06 | mr1289 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526045307 | 6.62E-06 | NA | mr1348 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526045307 | 3.46E-06 | 3.46E-06 | mr1348 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526045307 | NA | 3.57E-08 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526045307 | NA | 7.88E-08 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526045307 | NA | 1.24E-07 | mr1571 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526045307 | NA | 4.39E-07 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526045307 | 5.59E-06 | 5.58E-06 | mr1939 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526045307 | NA | 1.54E-06 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526045307 | NA | 1.49E-06 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526045307 | NA | 5.65E-07 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |