\
| Variant ID: vg0526033573 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 26033573 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 77. )
GAAAGGATGAGGTCTGAGGGGAAGGGCGGACGAGGAGGGCGGATGGCGCGGGCCGGAGGTGCGAGCGGAGAGCTTTGGGCAGGGGGGACGGCGGCGCAGG[C/T]
GGCAGGGATGGCTTGGGTTGGCGGCGTAGGCGGCGGGGACGGCGACAGACGGCGGGGATGGCGTGGGTTGCTGGCGTAGATGGCGGGGACGGCGACGGGC
GCCCGTCGCCGTCCCCGCCATCTACGCCAGCAACCCACGCCATCCCCGCCGTCTGTCGCCGTCCCCGCCGCCTACGCCGCCAACCCAAGCCATCCCTGCC[G/A]
CCTGCGCCGCCGTCCCCCCTGCCCAAAGCTCTCCGCTCGCACCTCCGGCCCGCGCCATCCGCCCTCCTCGTCCGCCCTTCCCCTCAGACCTCATCCTTTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.10% | 3.90% | 1.02% | 34.02% | NA |
| All Indica | 2759 | 40.60% | 6.60% | 1.38% | 51.40% | NA |
| All Japonica | 1512 | 99.40% | 0.00% | 0.00% | 0.60% | NA |
| Aus | 269 | 37.20% | 0.00% | 3.72% | 59.11% | NA |
| Indica I | 595 | 33.60% | 22.70% | 2.52% | 41.18% | NA |
| Indica II | 465 | 34.60% | 0.40% | 0.43% | 64.52% | NA |
| Indica III | 913 | 48.60% | 0.30% | 1.42% | 49.62% | NA |
| Indica Intermediate | 786 | 40.20% | 5.30% | 1.02% | 53.44% | NA |
| Temperate Japonica | 767 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 0.00% | 0.00% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0526033573 | C -> T | LOC_Os05g44780.1 | upstream_gene_variant ; 2212.0bp to feature; MODIFIER | silent_mutation | Average:32.714; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 | N | N | N | N |
| vg0526033573 | C -> T | LOC_Os05g44786.1 | downstream_gene_variant ; 1505.0bp to feature; MODIFIER | silent_mutation | Average:32.714; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 | N | N | N | N |
| vg0526033573 | C -> T | LOC_Os05g44780-LOC_Os05g44786 | intergenic_region ; MODIFIER | silent_mutation | Average:32.714; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 | N | N | N | N |
| vg0526033573 | C -> DEL | N | N | silent_mutation | Average:32.714; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0526033573 | NA | 9.91E-08 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526033573 | NA | 1.65E-07 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526033573 | NA | 2.23E-09 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526033573 | NA | 1.02E-08 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526033573 | NA | 7.33E-08 | mr1571 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526033573 | NA | 3.82E-08 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526033573 | NA | 1.01E-07 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526033573 | NA | 1.27E-06 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526033573 | NA | 4.91E-07 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526033573 | NA | 2.20E-07 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |