\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0526033573:

Variant ID: vg0526033573 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 26033573
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:


GAAAGGATGAGGTCTGAGGGGAAGGGCGGACGAGGAGGGCGGATGGCGCGGGCCGGAGGTGCGAGCGGAGAGCTTTGGGCAGGGGGGACGGCGGCGCAGG[C/T]
GGCAGGGATGGCTTGGGTTGGCGGCGTAGGCGGCGGGGACGGCGACAGACGGCGGGGATGGCGTGGGTTGCTGGCGTAGATGGCGGGGACGGCGACGGGC

Reverse complement sequence

GCCCGTCGCCGTCCCCGCCATCTACGCCAGCAACCCACGCCATCCCCGCCGTCTGTCGCCGTCCCCGCCGCCTACGCCGCCAACCCAAGCCATCCCTGCC[G/A]
CCTGCGCCGCCGTCCCCCCTGCCCAAAGCTCTCCGCTCGCACCTCCGGCCCGCGCCATCCGCCCTCCTCGTCCGCCCTTCCCCTCAGACCTCATCCTTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.10% 3.90% 1.02% 34.02% NA
All Indica  2759 40.60% 6.60% 1.38% 51.40% NA
All Japonica  1512 99.40% 0.00% 0.00% 0.60% NA
Aus  269 37.20% 0.00% 3.72% 59.11% NA
Indica I  595 33.60% 22.70% 2.52% 41.18% NA
Indica II  465 34.60% 0.40% 0.43% 64.52% NA
Indica III  913 48.60% 0.30% 1.42% 49.62% NA
Indica Intermediate  786 40.20% 5.30% 1.02% 53.44% NA
Temperate Japonica  767 99.00% 0.00% 0.00% 1.04% NA
Tropical Japonica  504 99.80% 0.00% 0.00% 0.20% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 75.60% 0.00% 0.00% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0526033573 C -> T LOC_Os05g44780.1 upstream_gene_variant ; 2212.0bp to feature; MODIFIER silent_mutation Average:32.714; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 N N N N
vg0526033573 C -> T LOC_Os05g44786.1 downstream_gene_variant ; 1505.0bp to feature; MODIFIER silent_mutation Average:32.714; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 N N N N
vg0526033573 C -> T LOC_Os05g44780-LOC_Os05g44786 intergenic_region ; MODIFIER silent_mutation Average:32.714; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 N N N N
vg0526033573 C -> DEL N N silent_mutation Average:32.714; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0526033573 NA 9.91E-08 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526033573 NA 1.65E-07 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526033573 NA 2.23E-09 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526033573 NA 1.02E-08 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526033573 NA 7.33E-08 mr1571 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526033573 NA 3.82E-08 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526033573 NA 1.01E-07 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526033573 NA 1.27E-06 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526033573 NA 4.91E-07 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526033573 NA 2.20E-07 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251