\
| Variant ID: vg0526013924 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 26013924 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 331. )
CACCCCCCGTGTCAGGCGGCAAGATTTGACAGGCCCCATCATCAAGACGACGTGTGCTTGGCTTCCCAAGTCAGGAGACAAGACATGCATTTAATGCAAA[G/C]
ATTATAATACTTCTCCACCGGAGCTAGGTTAGGTTGTTGGGCCCATGTGGTAACCCCTTGAGGTATAAAAGGAGGTCCAGGCCTAGTGGTGGAGGGGGGG
CCCCCCCTCCACCACTAGGCCTGGACCTCCTTTTATACCTCAAGGGGTTACCACATGGGCCCAACAACCTAACCTAGCTCCGGTGGAGAAGTATTATAAT[C/G]
TTTGCATTAAATGCATGTCTTGTCTCCTGACTTGGGAAGCCAAGCACACGTCGTCTTGATGATGGGGCCTGTCAAATCTTGCCGCCTGACACGGGGGGTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.40% | 6.60% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 7.40% | 92.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.20% | 3.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0526013924 | G -> C | LOC_Os05g44740.1 | upstream_gene_variant ; 278.0bp to feature; MODIFIER | silent_mutation | Average:63.689; most accessible tissue: Minghui63 flag leaf, score: 81.052 | N | N | N | N |
| vg0526013924 | G -> C | LOC_Os05g44750.1 | upstream_gene_variant ; 689.0bp to feature; MODIFIER | silent_mutation | Average:63.689; most accessible tissue: Minghui63 flag leaf, score: 81.052 | N | N | N | N |
| vg0526013924 | G -> C | LOC_Os05g44760.1 | upstream_gene_variant ; 3371.0bp to feature; MODIFIER | silent_mutation | Average:63.689; most accessible tissue: Minghui63 flag leaf, score: 81.052 | N | N | N | N |
| vg0526013924 | G -> C | LOC_Os05g44740-LOC_Os05g44750 | intergenic_region ; MODIFIER | silent_mutation | Average:63.689; most accessible tissue: Minghui63 flag leaf, score: 81.052 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0526013924 | NA | 1.47E-08 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 4.56E-06 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | 3.08E-06 | 1.85E-29 | mr1095 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 3.84E-38 | mr1098 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 3.56E-32 | mr1099 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 2.50E-32 | mr1101 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 1.94E-18 | mr1113 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 1.27E-20 | mr1114 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 9.64E-21 | mr1117 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 7.41E-18 | mr1119 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 3.61E-27 | mr1120 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 1.55E-26 | mr1123 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 5.47E-07 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 2.16E-15 | mr1146 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 1.23E-24 | mr1150 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 5.95E-15 | mr1158 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 2.04E-06 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 3.66E-06 | mr1230 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 6.37E-11 | mr1232 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 3.16E-18 | mr1240 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 1.89E-26 | mr1247 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 2.98E-06 | mr1262 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 6.96E-10 | mr1348 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 7.48E-06 | mr1349 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 1.08E-06 | mr1365 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 7.51E-06 | mr1367 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 5.12E-06 | mr1397 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 6.14E-06 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 5.29E-06 | mr1523 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 4.84E-39 | mr1549 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 9.17E-42 | mr1550 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 6.17E-29 | mr1589 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 7.52E-06 | mr1634 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 1.07E-06 | mr1652 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 3.15E-08 | mr1669 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 1.32E-09 | mr1730 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 2.29E-40 | mr1757 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 3.24E-07 | mr1762 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 4.60E-06 | mr1774 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 2.83E-06 | mr1803 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 9.12E-32 | mr1858 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 8.31E-32 | mr1859 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 9.86E-31 | mr1868 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 2.03E-21 | mr1911 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 2.05E-14 | mr1918 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 1.75E-19 | mr1936 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 1.08E-08 | mr1939 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 1.41E-21 | mr1961 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 1.27E-23 | mr1095_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 1.14E-33 | mr1098_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 1.13E-26 | mr1099_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 1.39E-22 | mr1120_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 3.28E-18 | mr1240_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 3.79E-23 | mr1247_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 3.86E-31 | mr1549_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 3.00E-47 | mr1550_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 4.92E-17 | mr1911_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 1.81E-13 | mr1918_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 5.48E-06 | mr1929_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0526013924 | NA | 3.41E-17 | mr1961_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |