Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0525982490:

Variant ID: vg0525982490 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 25982490
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.10, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

TTTGTGTTCACAATGATGCGACCCAATGCTGTTAAAATCCTTTTTAGTGCGGTTTTATAATTCTTTAAGAATTAACACGATGCAAACAAAAGGTGCCCAA[C/T]
AGAAAGGTGTTATACCGTTTTTGAAAGCTTTATTAGGCTGCAAAGGCTGTCTGGGTTGATTTGAGATGACTGGTTTATTAATAGTCATTCTTTTAACATG

Reverse complement sequence

CATGTTAAAAGAATGACTATTAATAAACCAGTCATCTCAAATCAACCCAGACAGCCTTTGCAGCCTAATAAAGCTTTCAAAAACGGTATAACACCTTTCT[G/A]
TTGGGCACCTTTTGTTTGCATCGTGTTAATTCTTAAAGAATTATAAAACCGCACTAAAAAGGATTTTAACAGCATTGGGTCGCATCATTGTGAACACAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.30%	45.50%	0.15%	0.00%	NA
All Indica	2759	91.00%	8.70%	0.22%	0.00%	NA
All Japonica	1512	0.90%	99.10%	0.00%	0.00%	NA
Aus	269	3.00%	97.00%	0.00%	0.00%	NA
Indica I	595	98.00%	1.80%	0.17%	0.00%	NA
Indica II	465	77.60%	21.70%	0.65%	0.00%	NA
Indica III	913	94.50%	5.30%	0.22%	0.00%	NA
Indica Intermediate	786	89.70%	10.30%	0.00%	0.00%	NA
Temperate Japonica	767	1.30%	98.70%	0.00%	0.00%	NA
Tropical Japonica	504	0.40%	99.60%	0.00%	0.00%	NA
Japonica Intermediate	241	0.40%	99.60%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	36.70%	62.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0525982490	C -> T	LOC_Os05g44670.1	upstream_gene_variant ; 5000.0bp to feature; MODIFIER	silent_mutation	Average:27.491; most accessible tissue: Minghui63 root, score: 38.567	N	N	N	N
vg0525982490	C -> T	LOC_Os05g44680.1	upstream_gene_variant ; 440.0bp to feature; MODIFIER	silent_mutation	Average:27.491; most accessible tissue: Minghui63 root, score: 38.567	N	N	N	N
vg0525982490	C -> T	LOC_Os05g44690.1	upstream_gene_variant ; 4455.0bp to feature; MODIFIER	silent_mutation	Average:27.491; most accessible tissue: Minghui63 root, score: 38.567	N	N	N	N
vg0525982490	C -> T	LOC_Os05g44680-LOC_Os05g44690	intergenic_region ; MODIFIER	silent_mutation	Average:27.491; most accessible tissue: Minghui63 root, score: 38.567	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0525982490	NA	1.30E-13	mr1032	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525982490	NA	5.81E-07	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525982490	NA	1.24E-50	mr1109	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525982490	NA	3.73E-34	mr1129	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525982490	NA	3.31E-16	mr1199	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525982490	NA	6.82E-18	mr1253	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525982490	NA	1.15E-18	mr1255	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525982490	NA	1.27E-09	mr1299	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525982490	NA	7.30E-16	mr1592	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525982490	NA	4.67E-09	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525982490	NA	2.60E-12	mr1657	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525982490	NA	4.77E-16	mr1700	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525982490	NA	3.26E-06	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525982490	NA	2.88E-07	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525982490	NA	3.84E-35	mr1828	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525982490	NA	6.62E-06	mr1837	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525982490	NA	1.85E-11	mr1883	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525982490	NA	2.62E-08	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525982490	1.61E-07	3.03E-17	mr1938	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525982490	2.75E-06	2.75E-06	mr1938	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525982490	NA	9.83E-56	mr1109_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525982490	NA	2.66E-21	mr1253_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525982490	NA	5.40E-09	mr1478_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525982490	NA	3.37E-09	mr1649_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525982490	NA	1.80E-09	mr1828_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525982490	NA	1.04E-08	mr1934_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525982490	NA	3.10E-14	mr1938_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251