\
| Variant ID: vg0525976899 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 25976899 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 272. )
TCTCTAAGGTTACCGTTTTGGCTTCGTTCCTAAGATGAATCCTCTGCAAGACAGTTTAATGAGCACATGAATTAAATGGCAAACAAGATGGTTGAAATCA[A/G]
GTACCAGAGGGCTTACATTTACAATACGGGTTGCTTGACCAAGTGCCTTCTTCAGTAGGCATAACTCTTCGTCCTCTTTTTGCTTATTTATCACGATCCC
GGGATCGTGATAAATAAGCAAAAAGAGGACGAAGAGTTATGCCTACTGAAGAAGGCACTTGGTCAAGCAACCCGTATTGTAAATGTAAGCCCTCTGGTAC[T/C]
TGATTTCAACCATCTTGTTTGCCATTTAATTCATGTGCTCATTAAACTGTCTTGCAGAGGATTCATCTTAGGAACGAAGCCAAAACGGTAACCTTAGAGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.20% | 37.70% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 94.70% | 5.10% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 0.90% | 99.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.20% | 0.50% | 0.00% | NA |
| Indica II | 465 | 79.60% | 20.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.50% | 5.10% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 1.40% | 98.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 3.10% | 96.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 47.80% | 52.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0525976899 | A -> G | LOC_Os05g44650.1 | downstream_gene_variant ; 4839.0bp to feature; MODIFIER | silent_mutation | Average:51.539; most accessible tissue: Minghui63 young leaf, score: 68.745 | N | N | N | N |
| vg0525976899 | A -> G | LOC_Os05g44660.1 | downstream_gene_variant ; 1778.0bp to feature; MODIFIER | silent_mutation | Average:51.539; most accessible tissue: Minghui63 young leaf, score: 68.745 | N | N | N | N |
| vg0525976899 | A -> G | LOC_Os05g44680.1 | downstream_gene_variant ; 4168.0bp to feature; MODIFIER | silent_mutation | Average:51.539; most accessible tissue: Minghui63 young leaf, score: 68.745 | N | N | N | N |
| vg0525976899 | A -> G | LOC_Os05g44670.1 | intron_variant ; MODIFIER | silent_mutation | Average:51.539; most accessible tissue: Minghui63 young leaf, score: 68.745 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0525976899 | NA | 2.43E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 3.37E-11 | mr1281 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 9.43E-14 | mr1478 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 1.46E-36 | mr1719 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 4.44E-16 | mr1842 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 9.56E-62 | mr1889 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 3.43E-81 | mr1896 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 1.52E-10 | mr1896 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 1.79E-11 | mr1902 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 2.50E-31 | mr1903 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 4.21E-09 | mr1903 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 3.75E-87 | mr1907 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 6.21E-12 | mr1907 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 3.21E-07 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 1.42E-83 | mr1934 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 4.07E-11 | mr1934 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 2.94E-60 | mr1935 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 7.32E-11 | mr1935 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 3.34E-06 | mr1115_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 4.16E-26 | mr1149_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 1.07E-16 | mr1162_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 1.26E-21 | mr1175_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 5.12E-11 | mr1193_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 2.66E-06 | mr1193_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 3.09E-24 | mr1195_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 2.63E-12 | mr1195_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 4.45E-20 | mr1281_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 2.76E-16 | mr1342_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 6.89E-06 | mr1428_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 1.49E-11 | mr1537_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 7.93E-07 | mr1567_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 9.45E-27 | mr1588_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 8.53E-06 | mr1588_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 4.44E-18 | mr1592_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 2.24E-19 | mr1637_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 1.92E-14 | mr1713_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 4.15E-07 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 4.25E-10 | mr1756_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 1.06E-07 | mr1783_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 5.32E-06 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 6.63E-16 | mr1790_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 2.66E-06 | mr1806_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | 2.55E-12 | 6.12E-80 | mr1828_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | 3.23E-14 | 3.27E-21 | mr1828_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 1.01E-07 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 3.19E-17 | mr1842_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 5.69E-18 | mr1874_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 1.48E-70 | mr1889_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 4.66E-08 | mr1889_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 2.64E-30 | mr1891_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 4.82E-68 | mr1896_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 3.51E-07 | mr1896_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 5.47E-100 | mr1907_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 2.87E-13 | mr1907_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 1.47E-06 | mr1915_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 2.16E-22 | mr1933_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 8.65E-85 | mr1934_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 8.20E-12 | mr1934_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | 8.00E-06 | 7.31E-17 | mr1938_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | 1.69E-06 | 3.20E-08 | mr1938_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525976899 | NA | 1.84E-09 | mr1947_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |