\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0525973696:

Variant ID: vg0525973696 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 25973696
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


GGACAGTCTCGACGAAAGATTTGGATGGCTACCTCAGCTCCCCCGGCGTCAGTTCTCGACCAACCGAGATCCTCGACTACGACGATTTCGGCTACCACTA[T/C]
GACCACGGCGACCTCGACAACTTCGACGACAGTTATGAGGATAACTACACGCCCCTCTTCTTCGGCGTATTCATGGCTGACAACGAAACGGAGGAACATC

Reverse complement sequence

GATGTTCCTCCGTTTCGTTGTCAGCCATGAATACGCCGAAGAAGAGGGGCGTGTAGTTATCCTCATAACTGTCGTCGAAGTTGTCGAGGTCGCCGTGGTC[A/G]
TAGTGGTAGCCGAAATCGTCGTAGTCGAGGATCTCGGTTGGTCGAGAACTGACGCCGGGGGAGCTGAGGTAGCCATCCAAATCTTTCGTCGAGACTGTCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.80% 10.30% 23.85% 26.05% NA
All Indica  2759 7.80% 13.90% 35.01% 43.24% NA
All Japonica  1512 99.30% 0.10% 0.07% 0.60% NA
Aus  269 5.90% 35.70% 54.28% 4.09% NA
Indica I  595 4.50% 5.70% 28.07% 61.68% NA
Indica II  465 22.20% 7.70% 27.10% 43.01% NA
Indica III  913 2.50% 22.70% 43.59% 31.22% NA
Indica Intermediate  786 8.00% 13.60% 34.99% 43.38% NA
Temperate Japonica  767 98.80% 0.00% 0.00% 1.17% NA
Tropical Japonica  504 99.60% 0.20% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 0.00% 2.08% 1.04% NA
Intermediate  90 60.00% 7.80% 13.33% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0525973696 T -> DEL N N silent_mutation Average:12.192; most accessible tissue: Callus, score: 35.723 N N N N
vg0525973696 T -> C LOC_Os05g44640.1 downstream_gene_variant ; 4779.0bp to feature; MODIFIER silent_mutation Average:12.192; most accessible tissue: Callus, score: 35.723 N N N N
vg0525973696 T -> C LOC_Os05g44650.1 downstream_gene_variant ; 1636.0bp to feature; MODIFIER silent_mutation Average:12.192; most accessible tissue: Callus, score: 35.723 N N N N
vg0525973696 T -> C LOC_Os05g44670.1 downstream_gene_variant ; 2255.0bp to feature; MODIFIER silent_mutation Average:12.192; most accessible tissue: Callus, score: 35.723 N N N N
vg0525973696 T -> C LOC_Os05g44660.1 intron_variant ; MODIFIER silent_mutation Average:12.192; most accessible tissue: Callus, score: 35.723 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0525973696 NA 1.28E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525973696 NA 1.89E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525973696 NA 7.51E-06 mr1415_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525973696 NA 5.37E-06 mr1562_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525973696 NA 4.02E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525973696 NA 1.95E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525973696 5.05E-06 NA mr1828_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525973696 4.08E-06 7.03E-09 mr1828_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525973696 NA 1.85E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525973696 NA 9.19E-08 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525973696 NA 3.87E-15 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525973696 4.85E-06 NA mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525973696 4.55E-06 3.20E-08 mr1982_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251