\
| Variant ID: vg0525973696 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 25973696 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 93. )
GGACAGTCTCGACGAAAGATTTGGATGGCTACCTCAGCTCCCCCGGCGTCAGTTCTCGACCAACCGAGATCCTCGACTACGACGATTTCGGCTACCACTA[T/C]
GACCACGGCGACCTCGACAACTTCGACGACAGTTATGAGGATAACTACACGCCCCTCTTCTTCGGCGTATTCATGGCTGACAACGAAACGGAGGAACATC
GATGTTCCTCCGTTTCGTTGTCAGCCATGAATACGCCGAAGAAGAGGGGCGTGTAGTTATCCTCATAACTGTCGTCGAAGTTGTCGAGGTCGCCGTGGTC[A/G]
TAGTGGTAGCCGAAATCGTCGTAGTCGAGGATCTCGGTTGGTCGAGAACTGACGCCGGGGGAGCTGAGGTAGCCATCCAAATCTTTCGTCGAGACTGTCC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.80% | 10.30% | 23.85% | 26.05% | NA |
| All Indica | 2759 | 7.80% | 13.90% | 35.01% | 43.24% | NA |
| All Japonica | 1512 | 99.30% | 0.10% | 0.07% | 0.60% | NA |
| Aus | 269 | 5.90% | 35.70% | 54.28% | 4.09% | NA |
| Indica I | 595 | 4.50% | 5.70% | 28.07% | 61.68% | NA |
| Indica II | 465 | 22.20% | 7.70% | 27.10% | 43.01% | NA |
| Indica III | 913 | 2.50% | 22.70% | 43.59% | 31.22% | NA |
| Indica Intermediate | 786 | 8.00% | 13.60% | 34.99% | 43.38% | NA |
| Temperate Japonica | 767 | 98.80% | 0.00% | 0.00% | 1.17% | NA |
| Tropical Japonica | 504 | 99.60% | 0.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 2.08% | 1.04% | NA |
| Intermediate | 90 | 60.00% | 7.80% | 13.33% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0525973696 | T -> DEL | N | N | silent_mutation | Average:12.192; most accessible tissue: Callus, score: 35.723 | N | N | N | N |
| vg0525973696 | T -> C | LOC_Os05g44640.1 | downstream_gene_variant ; 4779.0bp to feature; MODIFIER | silent_mutation | Average:12.192; most accessible tissue: Callus, score: 35.723 | N | N | N | N |
| vg0525973696 | T -> C | LOC_Os05g44650.1 | downstream_gene_variant ; 1636.0bp to feature; MODIFIER | silent_mutation | Average:12.192; most accessible tissue: Callus, score: 35.723 | N | N | N | N |
| vg0525973696 | T -> C | LOC_Os05g44670.1 | downstream_gene_variant ; 2255.0bp to feature; MODIFIER | silent_mutation | Average:12.192; most accessible tissue: Callus, score: 35.723 | N | N | N | N |
| vg0525973696 | T -> C | LOC_Os05g44660.1 | intron_variant ; MODIFIER | silent_mutation | Average:12.192; most accessible tissue: Callus, score: 35.723 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0525973696 | NA | 1.28E-07 | mr1030_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525973696 | NA | 1.89E-06 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525973696 | NA | 7.51E-06 | mr1415_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525973696 | NA | 5.37E-06 | mr1562_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525973696 | NA | 4.02E-06 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525973696 | NA | 1.95E-07 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525973696 | 5.05E-06 | NA | mr1828_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525973696 | 4.08E-06 | 7.03E-09 | mr1828_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525973696 | NA | 1.85E-07 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525973696 | NA | 9.19E-08 | mr1915_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525973696 | NA | 3.87E-15 | mr1938_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525973696 | 4.85E-06 | NA | mr1940_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525973696 | 4.55E-06 | 3.20E-08 | mr1982_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |