\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0525944770:

Variant ID: vg0525944770 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 25944770
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


TGATCTGCTTAATAAATAAAAACATGAGGGAGTTAATTTATATCATTCAAGAATCAGGACCCAGTCTTAGCAGTTAGCATTTAATATTTCTTGTAAATGG[G/A]
ACAATTGAATCATTCATTTAGAATAGACTGATATCCAATATTTCAGAATTTCCTTCACTTGGTCACAATATCTCTATCAAACTTTTGGAGAATCATGTAC

Reverse complement sequence

GTACATGATTCTCCAAAAGTTTGATAGAGATATTGTGACCAAGTGAAGGAAATTCTGAAATATTGGATATCAGTCTATTCTAAATGAATGATTCAATTGT[C/T]
CCATTTACAAGAAATATTAAATGCTAACTGCTAAGACTGGGTCCTGATTCTTGAATGATATAAATTAACTCCCTCATGTTTTTATTTATTAAGCAGATCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.70% 6.20% 0.19% 0.00% NA
All Indica  2759 99.90% 0.10% 0.04% 0.00% NA
All Japonica  1512 80.90% 18.60% 0.53% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.10% 0.13% 0.00% NA
Temperate Japonica  767 97.10% 2.70% 0.13% 0.00% NA
Tropical Japonica  504 54.80% 44.20% 0.99% 0.00% NA
Japonica Intermediate  241 83.80% 15.40% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0525944770 G -> A LOC_Os05g44600.1 upstream_gene_variant ; 4338.0bp to feature; MODIFIER silent_mutation Average:42.719; most accessible tissue: Callus, score: 78.072 N N N N
vg0525944770 G -> A LOC_Os05g44590.2 intron_variant ; MODIFIER silent_mutation Average:42.719; most accessible tissue: Callus, score: 78.072 N N N N
vg0525944770 G -> A LOC_Os05g44590.5 intron_variant ; MODIFIER silent_mutation Average:42.719; most accessible tissue: Callus, score: 78.072 N N N N
vg0525944770 G -> A LOC_Os05g44590.4 intron_variant ; MODIFIER silent_mutation Average:42.719; most accessible tissue: Callus, score: 78.072 N N N N
vg0525944770 G -> A LOC_Os05g44590.3 intron_variant ; MODIFIER silent_mutation Average:42.719; most accessible tissue: Callus, score: 78.072 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0525944770 NA 6.13E-06 mr1040 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525944770 1.34E-08 NA mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525944770 2.60E-06 4.43E-13 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525944770 2.25E-07 NA mr1194_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525944770 4.00E-06 5.40E-10 mr1194_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525944770 NA 6.87E-17 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525944770 NA 1.29E-06 mr1715_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251