Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0525944770:

Variant ID: vg0525944770 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 25944770
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

TGATCTGCTTAATAAATAAAAACATGAGGGAGTTAATTTATATCATTCAAGAATCAGGACCCAGTCTTAGCAGTTAGCATTTAATATTTCTTGTAAATGG[G/A]
ACAATTGAATCATTCATTTAGAATAGACTGATATCCAATATTTCAGAATTTCCTTCACTTGGTCACAATATCTCTATCAAACTTTTGGAGAATCATGTAC

Reverse complement sequence

GTACATGATTCTCCAAAAGTTTGATAGAGATATTGTGACCAAGTGAAGGAAATTCTGAAATATTGGATATCAGTCTATTCTAAATGAATGATTCAATTGT[C/T]
CCATTTACAAGAAATATTAAATGCTAACTGCTAAGACTGGGTCCTGATTCTTGAATGATATAAATTAACTCCCTCATGTTTTTATTTATTAAGCAGATCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.70%	6.20%	0.19%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.04%	0.00%	NA
All Japonica	1512	80.90%	18.60%	0.53%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.10%	0.13%	0.00%	NA
Temperate Japonica	767	97.10%	2.70%	0.13%	0.00%	NA
Tropical Japonica	504	54.80%	44.20%	0.99%	0.00%	NA
Japonica Intermediate	241	83.80%	15.40%	0.83%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	7.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0525944770	G -> A	LOC_Os05g44600.1	upstream_gene_variant ; 4338.0bp to feature; MODIFIER	silent_mutation	Average:42.719; most accessible tissue: Callus, score: 78.072	N	N	N	N
vg0525944770	G -> A	LOC_Os05g44590.2	intron_variant ; MODIFIER	silent_mutation	Average:42.719; most accessible tissue: Callus, score: 78.072	N	N	N	N
vg0525944770	G -> A	LOC_Os05g44590.5	intron_variant ; MODIFIER	silent_mutation	Average:42.719; most accessible tissue: Callus, score: 78.072	N	N	N	N
vg0525944770	G -> A	LOC_Os05g44590.4	intron_variant ; MODIFIER	silent_mutation	Average:42.719; most accessible tissue: Callus, score: 78.072	N	N	N	N
vg0525944770	G -> A	LOC_Os05g44590.3	intron_variant ; MODIFIER	silent_mutation	Average:42.719; most accessible tissue: Callus, score: 78.072	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0525944770	NA	6.13E-06	mr1040	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525944770	1.34E-08	NA	mr1194	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525944770	2.60E-06	4.43E-13	mr1194	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525944770	2.25E-07	NA	mr1194_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525944770	4.00E-06	5.40E-10	mr1194_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525944770	NA	6.87E-17	mr1715_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525944770	NA	1.29E-06	mr1715_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251