\
| Variant ID: vg0525944770 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 25944770 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 286. )
TGATCTGCTTAATAAATAAAAACATGAGGGAGTTAATTTATATCATTCAAGAATCAGGACCCAGTCTTAGCAGTTAGCATTTAATATTTCTTGTAAATGG[G/A]
ACAATTGAATCATTCATTTAGAATAGACTGATATCCAATATTTCAGAATTTCCTTCACTTGGTCACAATATCTCTATCAAACTTTTGGAGAATCATGTAC
GTACATGATTCTCCAAAAGTTTGATAGAGATATTGTGACCAAGTGAAGGAAATTCTGAAATATTGGATATCAGTCTATTCTAAATGAATGATTCAATTGT[C/T]
CCATTTACAAGAAATATTAAATGCTAACTGCTAAGACTGGGTCCTGATTCTTGAATGATATAAATTAACTCCCTCATGTTTTTATTTATTAAGCAGATCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.70% | 6.20% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 80.90% | 18.60% | 0.53% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 97.10% | 2.70% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 54.80% | 44.20% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 83.80% | 15.40% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0525944770 | G -> A | LOC_Os05g44600.1 | upstream_gene_variant ; 4338.0bp to feature; MODIFIER | silent_mutation | Average:42.719; most accessible tissue: Callus, score: 78.072 | N | N | N | N |
| vg0525944770 | G -> A | LOC_Os05g44590.2 | intron_variant ; MODIFIER | silent_mutation | Average:42.719; most accessible tissue: Callus, score: 78.072 | N | N | N | N |
| vg0525944770 | G -> A | LOC_Os05g44590.5 | intron_variant ; MODIFIER | silent_mutation | Average:42.719; most accessible tissue: Callus, score: 78.072 | N | N | N | N |
| vg0525944770 | G -> A | LOC_Os05g44590.4 | intron_variant ; MODIFIER | silent_mutation | Average:42.719; most accessible tissue: Callus, score: 78.072 | N | N | N | N |
| vg0525944770 | G -> A | LOC_Os05g44590.3 | intron_variant ; MODIFIER | silent_mutation | Average:42.719; most accessible tissue: Callus, score: 78.072 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0525944770 | NA | 6.13E-06 | mr1040 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525944770 | 1.34E-08 | NA | mr1194 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525944770 | 2.60E-06 | 4.43E-13 | mr1194 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525944770 | 2.25E-07 | NA | mr1194_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525944770 | 4.00E-06 | 5.40E-10 | mr1194_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525944770 | NA | 6.87E-17 | mr1715_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525944770 | NA | 1.29E-06 | mr1715_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |