Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0525927552:

Variant ID: vg0525927552 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 25927552
Reference Allele: TAlternative Allele: C,G
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.03, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


CAGCGAGAGCTTGACAGGAAATATTTCTGAATTCCCATCATGGAATGAACCATATTGGTTGTGTGAAAGTAGGAACTACTACTTGCATATTTCGGCCGGT[T/C,G]
TTAGGTCCCAACTTTTTCTTCAAAATTCTAACTTTTCTATCACATCAAAACTTTCCTACATACATAAACTTTCAACTTTTTTCTTTGAACTTTCAAATTT

Reverse complement sequence

AAATTTGAAAGTTCAAAGAAAAAAGTTGAAAGTTTATGTATGTAGGAAAGTTTTGATGTGATAGAAAAGTTAGAATTTTGAAGAAAAAGTTGGGACCTAA[A/G,C]
ACCGGCCGAAATATGCAAGTAGTAGTTCCTACTTTCACACAACCAATATGGTTCATTCCATGATGGGAATTCAGAAATATTTCCTGTCAAGCTCTCGCTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.20% 46.60% 0.19% 0.00% G: 0.04%
All Indica  2759 88.90% 10.70% 0.33% 0.00% G: 0.07%
All Japonica  1512 0.90% 99.10% 0.00% 0.00% NA
Aus  269 3.30% 96.70% 0.00% 0.00% NA
Indica I  595 99.30% 0.00% 0.67% 0.00% NA
Indica II  465 77.40% 22.60% 0.00% 0.00% NA
Indica III  913 88.70% 11.00% 0.11% 0.00% G: 0.22%
Indica Intermediate  786 88.00% 11.50% 0.51% 0.00% NA
Temperate Japonica  767 1.40% 98.60% 0.00% 0.00% NA
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 0.00% 100.00% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 40.00% 60.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0525927552 T -> G LOC_Os05g44560.1 upstream_gene_variant ; 1476.0bp to feature; MODIFIER silent_mutation Average:64.148; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg0525927552 T -> G LOC_Os05g44570.1 downstream_gene_variant ; 432.0bp to feature; MODIFIER silent_mutation Average:64.148; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg0525927552 T -> G LOC_Os05g44570.2 downstream_gene_variant ; 432.0bp to feature; MODIFIER silent_mutation Average:64.148; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg0525927552 T -> G LOC_Os05g44570.3 downstream_gene_variant ; 432.0bp to feature; MODIFIER silent_mutation Average:64.148; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg0525927552 T -> G LOC_Os05g44560-LOC_Os05g44570 intergenic_region ; MODIFIER silent_mutation Average:64.148; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg0525927552 T -> C LOC_Os05g44560.1 upstream_gene_variant ; 1476.0bp to feature; MODIFIER silent_mutation Average:64.148; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg0525927552 T -> C LOC_Os05g44570.1 downstream_gene_variant ; 432.0bp to feature; MODIFIER silent_mutation Average:64.148; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg0525927552 T -> C LOC_Os05g44570.2 downstream_gene_variant ; 432.0bp to feature; MODIFIER silent_mutation Average:64.148; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg0525927552 T -> C LOC_Os05g44570.3 downstream_gene_variant ; 432.0bp to feature; MODIFIER silent_mutation Average:64.148; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg0525927552 T -> C LOC_Os05g44560-LOC_Os05g44570 intergenic_region ; MODIFIER silent_mutation Average:64.148; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0525927552 T C 0.05 0.03 0.03 0.04 0.06 0.07
vg0525927552 T G 0.05 0.02 0.03 0.04 0.08 0.11

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0525927552 NA 7.31E-14 mr1032 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 3.25E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 2.52E-55 mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 3.30E-35 mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 2.87E-18 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 9.31E-19 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 3.78E-15 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 1.11E-09 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 1.41E-13 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 4.17E-19 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 2.85E-06 NA mr1612 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 6.62E-07 6.61E-07 mr1612 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 1.27E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 5.89E-13 mr1655 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 3.43E-11 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 9.04E-08 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 4.69E-16 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 2.17E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 6.06E-36 mr1828 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 1.04E-11 mr1883 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 9.01E-09 mr1896 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 2.87E-10 mr1907 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 1.24E-12 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 4.16E-10 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 8.16E-15 mr1938 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 2.57E-67 mr1109_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 4.67E-09 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 4.20E-06 NA mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 6.68E-36 mr1129_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 2.09E-13 mr1147_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 3.03E-17 mr1199_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 4.72E-06 NA mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 1.33E-24 mr1253_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 5.83E-06 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 7.94E-21 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 1.70E-22 mr1316_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 3.35E-10 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 8.52E-34 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 5.83E-09 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 2.45E-06 mr1612_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 1.72E-10 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 2.05E-12 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 2.55E-14 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 3.02E-49 mr1721_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 1.74E-08 NA mr1828_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 4.38E-09 1.17E-14 mr1828_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 9.54E-10 mr1907_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 9.49E-30 mr1932_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 2.44E-09 mr1934_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 1.94E-17 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525927552 NA 3.95E-07 mr1938_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251