| Variant ID: vg0525908966 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 25908966 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 218. )
GTATTACTTCTTGAATAAGAAGGCCTGAACCTGTATAAAATTTCTTGTCTCCAAACCCATCCACTTTCCTAGCTTGACAGCCACCCCCTTTTATTATTGC[T/C]
GAAATCTTGCTTCGACACAGCTTTAGAAAATAGATTTACAAATACTAGATGGAAGGACCTAGCCTATGTTGTGCATGAAACTGGTTGCCCATTTGAATAA
TTATTCAAATGGGCAACCAGTTTCATGCACAACATAGGCTAGGTCCTTCCATCTAGTATTTGTAAATCTATTTTCTAAAGCTGTGTCGAAGCAAGATTTC[A/G]
GCAATAATAAAAGGGGGTGGCTGTCAAGCTAGGAAAGTGGATGGGTTTGGAGACAAGAAATTTTATACAGGTTCAGGCCTTCTTATTCAAGAAGTAATAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.20% | 37.70% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 94.90% | 5.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 79.60% | 20.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 1.30% | 98.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 3.10% | 96.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 46.70% | 51.10% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0525908966 | T -> C | LOC_Os05g44520.1 | upstream_gene_variant ; 1440.0bp to feature; MODIFIER | silent_mutation | Average:33.948; most accessible tissue: Callus, score: 62.26 | N | N | N | N |
| vg0525908966 | T -> C | LOC_Os05g44530.1 | upstream_gene_variant ; 326.0bp to feature; MODIFIER | silent_mutation | Average:33.948; most accessible tissue: Callus, score: 62.26 | N | N | N | N |
| vg0525908966 | T -> C | LOC_Os05g44540.1 | upstream_gene_variant ; 1876.0bp to feature; MODIFIER | silent_mutation | Average:33.948; most accessible tissue: Callus, score: 62.26 | N | N | N | N |
| vg0525908966 | T -> C | LOC_Os05g44550.1 | upstream_gene_variant ; 4296.0bp to feature; MODIFIER | silent_mutation | Average:33.948; most accessible tissue: Callus, score: 62.26 | N | N | N | N |
| vg0525908966 | T -> C | LOC_Os05g44510.1 | downstream_gene_variant ; 4997.0bp to feature; MODIFIER | silent_mutation | Average:33.948; most accessible tissue: Callus, score: 62.26 | N | N | N | N |
| vg0525908966 | T -> C | LOC_Os05g44520-LOC_Os05g44530 | intergenic_region ; MODIFIER | silent_mutation | Average:33.948; most accessible tissue: Callus, score: 62.26 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0525908966 | NA | 1.54E-06 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525908966 | NA | 4.61E-15 | mr1113 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525908966 | NA | 1.14E-17 | mr1114 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525908966 | NA | 3.04E-16 | mr1119 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525908966 | NA | 9.57E-21 | mr1120 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525908966 | 1.53E-06 | NA | mr1498 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525908966 | NA | 6.62E-07 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525908966 | NA | 1.19E-21 | mr1817 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525908966 | NA | 9.21E-24 | mr1917 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525908966 | NA | 8.68E-22 | mr1120_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525908966 | NA | 4.44E-23 | mr1247_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525908966 | NA | 6.46E-16 | mr1587_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525908966 | NA | 5.61E-15 | mr1961_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |