\
| Variant ID: vg0525881431 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 25881431 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.02, others allele: 0.00, population size: 263. )
AGCATTCGTGCTTTCAAGATGAAACTAAACCCGGAAAAGTGCATCTTCGGAGTACCGTCAGGGAAATTGCTCGGATTTATGGTATCTCAAAGAGGCATAC[A/T]
GGCCAACCCGGAGAAAATCAACGCCATTCTCAACATGAAACCGCCAAGCTCCCAAAAAGACGTCCAAAAGTTGACTGGTTGCATGGCGGCGCTCAGCCGG
CCGGCTGAGCGCCGCCATGCAACCAGTCAACTTTTGGACGTCTTTTTGGGAGCTTGGCGGTTTCATGTTGAGAATGGCGTTGATTTTCTCCGGGTTGGCC[T/A]
GTATGCCTCTTTGAGATACCATAAATCCGAGCAATTTCCCTGACGGTACTCCGAAGATGCACTTTTCCGGGTTTAGTTTCATCTTGAAAGCACGAATGCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.40% | 0.40% | 22.34% | 34.83% | NA |
| All Indica | 2759 | 12.30% | 0.60% | 29.29% | 57.81% | NA |
| All Japonica | 1512 | 99.10% | 0.00% | 0.46% | 0.40% | NA |
| Aus | 269 | 6.70% | 0.70% | 85.50% | 7.06% | NA |
| Indica I | 595 | 6.70% | 0.30% | 20.00% | 72.94% | NA |
| Indica II | 465 | 25.20% | 0.40% | 21.72% | 52.69% | NA |
| Indica III | 913 | 10.20% | 0.90% | 40.09% | 48.85% | NA |
| Indica Intermediate | 786 | 11.30% | 0.60% | 28.24% | 59.80% | NA |
| Temperate Japonica | 767 | 98.60% | 0.00% | 0.78% | 0.65% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 1.04% | 2.08% | NA |
| Intermediate | 90 | 61.10% | 1.10% | 11.11% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0525881431 | A -> T | LOC_Os05g44470.1 | missense_variant ; p.Gln158Leu; MODERATE | nonsynonymous_codon ; Q158L | Average:14.781; most accessible tissue: Minghui63 panicle, score: 20.733 | possibly damaging |
1.633 |
DELETERIOUS | 0.00 |
| vg0525881431 | A -> DEL | LOC_Os05g44470.1 | N | frameshift_variant | Average:14.781; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0525881431 | NA | 2.05E-22 | mr1020 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525881431 | NA | 4.09E-17 | mr1032 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525881431 | NA | 3.33E-06 | mr1032 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525881431 | NA | 1.01E-16 | mr1165 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525881431 | NA | 1.72E-17 | mr1478 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525881431 | NA | 1.22E-06 | mr1478 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525881431 | NA | 1.48E-09 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525881431 | NA | 3.11E-08 | mr1896 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525881431 | 3.41E-06 | NA | mr1903 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525881431 | NA | 8.73E-22 | mr1971 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525881431 | NA | 1.75E-21 | mr1253_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525881431 | NA | 2.93E-22 | mr1316_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525881431 | NA | 1.78E-06 | mr1358_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525881431 | NA | 3.23E-09 | mr1478_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525881431 | NA | 2.73E-06 | mr1611_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525881431 | NA | 6.04E-09 | mr1828_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525881431 | NA | 6.09E-17 | mr1938_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |