| Variant ID: vg0525802961 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 25802961 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.00, others allele: 0.00, population size: 286. )
ATTGCAACTGATCAAGTGATGATAACCTTCTGCTTGACGGATGCGCTTTTAGAAGAAACCCATCATGTTCAGTGGGGCTTCCAAGGACCTGAAGCCCTTT[T/C]
GATGTTGCTCTTATGCCCAGCTATCCAATCTGATAGTAGAGACTTCCAGCCTGCGACAAACCAATTTAGCTTCAAAATTCAGATCTTTTTTCAGCAATTT
AAATTGCTGAAAAAAGATCTGAATTTTGAAGCTAAATTGGTTTGTCGCAGGCTGGAAGTCTCTACTATCAGATTGGATAGCTGGGCATAAGAGCAACATC[A/G]
AAAGGGCTTCAGGTCCTTGGAAGCCCCACTGAACATGATGGGTTTCTTCTAAAAGCGCATCCGTCAAGCAGAAGGTTATCATCACTTGATCAGTTGCAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.60% | 47.20% | 0.17% | 0.06% | NA |
| All Indica | 2759 | 88.10% | 11.60% | 0.18% | 0.11% | NA |
| All Japonica | 1512 | 0.50% | 99.40% | 0.07% | 0.00% | NA |
| Aus | 269 | 4.10% | 95.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.20% | 0.34% | 0.00% | NA |
| Indica II | 465 | 77.20% | 22.60% | 0.00% | 0.22% | NA |
| Indica III | 913 | 86.70% | 13.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 87.70% | 11.80% | 0.25% | 0.25% | NA |
| Temperate Japonica | 767 | 0.80% | 99.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 35.60% | 62.20% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0525802961 | T -> DEL | N | N | silent_mutation | Average:57.962; most accessible tissue: Callus, score: 85.431 | N | N | N | N |
| vg0525802961 | T -> C | LOC_Os05g44330.1 | 3_prime_UTR_variant ; 921.0bp to feature; MODIFIER | silent_mutation | Average:57.962; most accessible tissue: Callus, score: 85.431 | N | N | N | N |
| vg0525802961 | T -> C | LOC_Os05g44330.2 | 3_prime_UTR_variant ; 1202.0bp to feature; MODIFIER | silent_mutation | Average:57.962; most accessible tissue: Callus, score: 85.431 | N | N | N | N |
| vg0525802961 | T -> C | LOC_Os05g44330.5 | 3_prime_UTR_variant ; 921.0bp to feature; MODIFIER | silent_mutation | Average:57.962; most accessible tissue: Callus, score: 85.431 | N | N | N | N |
| vg0525802961 | T -> C | LOC_Os05g44350.1 | upstream_gene_variant ; 4669.0bp to feature; MODIFIER | silent_mutation | Average:57.962; most accessible tissue: Callus, score: 85.431 | N | N | N | N |
| vg0525802961 | T -> C | LOC_Os05g44340.1 | downstream_gene_variant ; 569.0bp to feature; MODIFIER | silent_mutation | Average:57.962; most accessible tissue: Callus, score: 85.431 | N | N | N | N |
| vg0525802961 | T -> C | LOC_Os05g44330.3 | downstream_gene_variant ; 2163.0bp to feature; MODIFIER | silent_mutation | Average:57.962; most accessible tissue: Callus, score: 85.431 | N | N | N | N |
| vg0525802961 | T -> C | LOC_Os05g44330.4 | downstream_gene_variant ; 2163.0bp to feature; MODIFIER | silent_mutation | Average:57.962; most accessible tissue: Callus, score: 85.431 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0525802961 | NA | 1.55E-32 | mr1026 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525802961 | NA | 4.29E-14 | mr1032 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525802961 | NA | 1.76E-55 | mr1109 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525802961 | NA | 5.55E-34 | mr1129 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525802961 | NA | 5.26E-15 | mr1165 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525802961 | NA | 1.91E-15 | mr1199 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525802961 | NA | 5.62E-19 | mr1253 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525802961 | NA | 2.81E-18 | mr1255 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525802961 | NA | 1.89E-14 | mr1261 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525802961 | NA | 1.39E-13 | mr1478 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/