\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0525615548:

Variant ID: vg0525615548 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 25615548
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.02, T: 0.01, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


TTCGTCCCCAACAAGACGCTGGACTTCCACCTCCACGGTACTTTCTACTCTCTCTCAGTTTCATATTATATGTCATTTTAATTTTTTTTCTTAGTCCAAC[C/A]
TTTCTAAGTTTGATTAAATTTATATAAAAATATAGTAACAACTATCACATCAATTTAGTTTCACTGGATGTATATATTCTGATACTACGTTTGTTTTGTG

Reverse complement sequence

CACAAAACAAACGTAGTATCAGAATATATACATCCAGTGAAACTAAATTGATGTGATAGTTGTTACTATATTTTTATATAAATTTAATCAAACTTAGAAA[G/T]
GTTGGACTAAGAAAAAAAATTAAAATGACATATAATATGAAACTGAGAGAGAGTAGAAAGTACCGTGGAGGTGGAAGTCCAGCGTCTTGTTGGGGACGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.00% 13.90% 0.08% 0.00% NA
All Indica  2759 95.60% 4.40% 0.04% 0.00% NA
All Japonica  1512 66.20% 33.70% 0.13% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 80.60% 19.10% 0.22% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 96.10% 3.90% 0.00% 0.00% NA
Temperate Japonica  767 90.50% 9.30% 0.26% 0.00% NA
Tropical Japonica  504 23.20% 76.80% 0.00% 0.00% NA
Japonica Intermediate  241 78.80% 21.20% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 80.00% 18.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0525615548 C -> A LOC_Os05g44030.1 upstream_gene_variant ; 298.0bp to feature; MODIFIER silent_mutation Average:63.323; most accessible tissue: Minghui63 root, score: 84.568 N N N N
vg0525615548 C -> A LOC_Os05g44020.4 downstream_gene_variant ; 4537.0bp to feature; MODIFIER silent_mutation Average:63.323; most accessible tissue: Minghui63 root, score: 84.568 N N N N
vg0525615548 C -> A LOC_Os05g44020.2 downstream_gene_variant ; 4537.0bp to feature; MODIFIER silent_mutation Average:63.323; most accessible tissue: Minghui63 root, score: 84.568 N N N N
vg0525615548 C -> A LOC_Os05g44020.3 downstream_gene_variant ; 4537.0bp to feature; MODIFIER silent_mutation Average:63.323; most accessible tissue: Minghui63 root, score: 84.568 N N N N
vg0525615548 C -> A LOC_Os05g44020-LOC_Os05g44030 intergenic_region ; MODIFIER silent_mutation Average:63.323; most accessible tissue: Minghui63 root, score: 84.568 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0525615548 NA 7.33E-09 mr1889 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525615548 NA 2.82E-09 mr1896 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525615548 NA 4.08E-09 mr1903 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525615548 NA 8.28E-12 mr1907 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525615548 NA 2.76E-10 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525615548 NA 3.02E-10 mr1935 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525615548 NA 2.49E-09 mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525615548 NA 1.23E-07 mr1193_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525615548 NA 7.73E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525615548 2.85E-07 2.60E-13 mr1195_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525615548 NA 8.06E-07 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525615548 NA 9.87E-07 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525615548 NA 1.54E-07 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525615548 NA 8.63E-07 mr1567_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525615548 NA 7.78E-06 mr1682_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525615548 NA 4.34E-07 mr1806_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525615548 4.60E-13 6.26E-20 mr1828_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525615548 NA 4.97E-08 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525615548 NA 3.27E-07 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525615548 NA 6.46E-13 mr1907_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525615548 NA 6.19E-11 mr1934_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525615548 NA 2.08E-07 mr1938_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251