\
| Variant ID: vg0525615548 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 25615548 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.02, T: 0.01, others allele: 0.00, population size: 108. )
TTCGTCCCCAACAAGACGCTGGACTTCCACCTCCACGGTACTTTCTACTCTCTCTCAGTTTCATATTATATGTCATTTTAATTTTTTTTCTTAGTCCAAC[C/A]
TTTCTAAGTTTGATTAAATTTATATAAAAATATAGTAACAACTATCACATCAATTTAGTTTCACTGGATGTATATATTCTGATACTACGTTTGTTTTGTG
CACAAAACAAACGTAGTATCAGAATATATACATCCAGTGAAACTAAATTGATGTGATAGTTGTTACTATATTTTTATATAAATTTAATCAAACTTAGAAA[G/T]
GTTGGACTAAGAAAAAAAATTAAAATGACATATAATATGAAACTGAGAGAGAGTAGAAAGTACCGTGGAGGTGGAAGTCCAGCGTCTTGTTGGGGACGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.00% | 13.90% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 95.60% | 4.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 66.20% | 33.70% | 0.13% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 80.60% | 19.10% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 90.50% | 9.30% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 23.20% | 76.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 78.80% | 21.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 18.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0525615548 | C -> A | LOC_Os05g44030.1 | upstream_gene_variant ; 298.0bp to feature; MODIFIER | silent_mutation | Average:63.323; most accessible tissue: Minghui63 root, score: 84.568 | N | N | N | N |
| vg0525615548 | C -> A | LOC_Os05g44020.4 | downstream_gene_variant ; 4537.0bp to feature; MODIFIER | silent_mutation | Average:63.323; most accessible tissue: Minghui63 root, score: 84.568 | N | N | N | N |
| vg0525615548 | C -> A | LOC_Os05g44020.2 | downstream_gene_variant ; 4537.0bp to feature; MODIFIER | silent_mutation | Average:63.323; most accessible tissue: Minghui63 root, score: 84.568 | N | N | N | N |
| vg0525615548 | C -> A | LOC_Os05g44020.3 | downstream_gene_variant ; 4537.0bp to feature; MODIFIER | silent_mutation | Average:63.323; most accessible tissue: Minghui63 root, score: 84.568 | N | N | N | N |
| vg0525615548 | C -> A | LOC_Os05g44020-LOC_Os05g44030 | intergenic_region ; MODIFIER | silent_mutation | Average:63.323; most accessible tissue: Minghui63 root, score: 84.568 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0525615548 | NA | 7.33E-09 | mr1889 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525615548 | NA | 2.82E-09 | mr1896 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525615548 | NA | 4.08E-09 | mr1903 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525615548 | NA | 8.28E-12 | mr1907 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525615548 | NA | 2.76E-10 | mr1934 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525615548 | NA | 3.02E-10 | mr1935 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525615548 | NA | 2.49E-09 | mr1089_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525615548 | NA | 1.23E-07 | mr1193_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525615548 | NA | 7.73E-06 | mr1194_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525615548 | 2.85E-07 | 2.60E-13 | mr1195_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525615548 | NA | 8.06E-07 | mr1253_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525615548 | NA | 9.87E-07 | mr1332_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525615548 | NA | 1.54E-07 | mr1428_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525615548 | NA | 8.63E-07 | mr1567_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525615548 | NA | 7.78E-06 | mr1682_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525615548 | NA | 4.34E-07 | mr1806_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525615548 | 4.60E-13 | 6.26E-20 | mr1828_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525615548 | NA | 4.97E-08 | mr1850_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525615548 | NA | 3.27E-07 | mr1896_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525615548 | NA | 6.46E-13 | mr1907_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525615548 | NA | 6.19E-11 | mr1934_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525615548 | NA | 2.08E-07 | mr1938_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |