\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0525590896:

Variant ID: vg0525590896 (JBrowse)Variation Type: INDEL
Chromosome: chr05Position: 25590896
Reference Allele: ATAlternative Allele: TT,A
Primary Allele: ATSecondary Allele: TT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATATTCACAACCAACTTTAATTTCTTTATTACAATTTGTAGAAATCAAATTTTAACTTATATGTTTATGCAATGATATATTACATATTAATTATCCTGTA[AT/TT,A]
TTTTTTTAGATTTTTTTATAATCATTTAATTAATATGCAATAAACAACTAGATTTTCACTCGAGTGATTTAAGAGAGATTTCCATACTACACACTACACT

Reverse complement sequence

AGTGTAGTGTGTAGTATGGAAATCTCTCTTAAATCACTCGAGTGAAAATCTAGTTGTTTATTGCATATTAATTAAATGATTATAAAAAAATCTAAAAAAA[AT/AA,T]
TACAGGATAATTAATATGTAATATATCATTGCATAAACATATAAGTTAAAATTTGATTTCTACAAATTGTAATAAAGAAATTAAAGTTGGTTGTGAATAT

Allele Frequencies:

Populations Population SizeFrequency of AT(primary allele) Frequency of TT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.40% 11.60% 0.80% 1.54% A: 0.61%
All Indica  2759 94.70% 1.40% 0.94% 1.92% A: 0.98%
All Japonica  1512 65.80% 32.10% 0.73% 1.19% A: 0.13%
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 80.90% 6.20% 4.30% 8.39% A: 0.22%
Indica III  913 96.90% 0.10% 0.11% 0.00% A: 2.85%
Indica Intermediate  786 96.40% 1.10% 0.64% 1.78% NA
Temperate Japonica  767 90.10% 9.90% 0.00% 0.00% NA
Tropical Japonica  504 23.00% 71.40% 1.98% 3.37% A: 0.20%
Japonica Intermediate  241 78.00% 20.70% 0.41% 0.41% A: 0.41%
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 81.10% 16.70% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0525590896 AT -> DEL N N silent_mutation Average:61.235; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg0525590896 AT -> A LOC_Os05g43990.1 upstream_gene_variant ; 1008.0bp to feature; MODIFIER silent_mutation Average:61.235; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg0525590896 AT -> A LOC_Os05g43970.1 downstream_gene_variant ; 4277.0bp to feature; MODIFIER silent_mutation Average:61.235; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg0525590896 AT -> A LOC_Os05g43970.2 downstream_gene_variant ; 4289.0bp to feature; MODIFIER silent_mutation Average:61.235; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg0525590896 AT -> A LOC_Os05g43970-LOC_Os05g43990 intergenic_region ; MODIFIER silent_mutation Average:61.235; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg0525590896 AT -> TT LOC_Os05g43990.1 upstream_gene_variant ; 1009.0bp to feature; MODIFIER silent_mutation Average:61.235; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg0525590896 AT -> TT LOC_Os05g43970.1 downstream_gene_variant ; 4276.0bp to feature; MODIFIER silent_mutation Average:61.235; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg0525590896 AT -> TT LOC_Os05g43970.2 downstream_gene_variant ; 4288.0bp to feature; MODIFIER silent_mutation Average:61.235; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg0525590896 AT -> TT LOC_Os05g43970-LOC_Os05g43990 intergenic_region ; MODIFIER silent_mutation Average:61.235; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0525590896 AT A 0.06 0.01 -0.01 0.04 0.08 0.09
vg0525590896 AT TT 0.01 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0525590896 NA 9.79E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525590896 NA 2.95E-07 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525590896 NA 3.15E-11 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525590896 NA 2.59E-09 mr1896 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525590896 NA 8.03E-10 mr1935 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525590896 NA 6.97E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525590896 NA 3.64E-11 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525590896 NA 2.56E-18 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525590896 NA 8.43E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525590896 NA 7.25E-07 mr1806_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525590896 2.83E-12 1.51E-19 mr1828_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525590896 NA 4.20E-06 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525590896 NA 1.04E-08 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525590896 NA 1.12E-10 mr1907_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525590896 NA 4.52E-06 mr1915_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525590896 NA 2.50E-08 mr1934_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525590896 5.16E-07 7.59E-09 mr1938_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251