Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0525579310:

Variant ID: vg0525579310 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 25579310
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 359. )

Flanking Sequence (100 bp) in Reference Genome:

CAACACCCCAAATCAACCCGGTCCTTCTAATGCTTATCATGCAGCATCACAGATGGACCAGATGACGTTTCTGGATGGCAGTGTTGTTTATGGACCTCAT[C/T]
TTCCATATGGATACTCCACCGAAAGAAGCGATTTCTACTGGAACCCTAGTGACGGGACATGAAGATAGCATATTGGGTTTCATACATTCTACTGCATCTG

Reverse complement sequence

CAGATGCAGTAGAATGTATGAAACCCAATATGCTATCTTCATGTCCCGTCACTAGGGTTCCAGTAGAAATCGCTTCTTTCGGTGGAGTATCCATATGGAA[G/A]
ATGAGGTCCATAAACAACACTGCCATCCAGAAACGTCATCTGGTCCATCTGTGATGCTGCATGATAAGCATTAGAAGGACCGGGTTGATTTGGGGTGTTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.10%	13.90%	0.00%	0.00%	NA
All Indica	2759	95.70%	4.30%	0.00%	0.00%	NA
All Japonica	1512	65.90%	34.10%	0.00%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	80.90%	19.10%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	96.30%	3.70%	0.00%	0.00%	NA
Temperate Japonica	767	90.10%	9.90%	0.00%	0.00%	NA
Tropical Japonica	504	23.20%	76.80%	0.00%	0.00%	NA
Japonica Intermediate	241	78.00%	22.00%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	82.20%	17.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0525579310	C -> T	LOC_Os05g43950.1	missense_variant ; p.Leu622Phe; MODERATE	nonsynonymous_codon ; L622F	Average:75.961; most accessible tissue: Callus, score: 88.078	possibly damaging	1.609	TOLERATED	0.09

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0525579310	NA	4.84E-07	mr1642	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525579310	NA	1.55E-08	mr1889	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525579310	NA	1.31E-09	mr1896	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525579310	NA	1.17E-08	mr1903	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525579310	NA	5.11E-11	mr1907	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525579310	NA	1.33E-10	mr1934	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525579310	NA	1.37E-10	mr1935	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525579310	NA	2.49E-09	mr1089_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525579310	NA	6.52E-07	mr1193_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525579310	NA	7.73E-06	mr1194_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525579310	NA	6.60E-12	mr1195_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525579310	NA	3.05E-06	mr1253_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525579310	NA	2.77E-06	mr1332_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525579310	NA	2.33E-06	mr1567_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525579310	4.43E-06	1.31E-06	mr1622_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525579310	NA	2.75E-07	mr1806_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525579310	4.59E-13	5.31E-20	mr1828_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525579310	NA	5.56E-07	mr1896_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525579310	NA	4.05E-12	mr1907_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525579310	NA	1.01E-10	mr1934_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525579310	2.24E-06	3.80E-08	mr1938_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251