Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0525568162:

Variant ID: vg0525568162 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 25568162
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.57, G: 0.43, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

AAGGAGTTCTCATCCTCACTTCACTCACACACCTCAAGCAATAGCTCTCTCATTTATCTCAAGTTTAGTTTAGTAGTATCTAGTTGGTGGAATAGAAATA[A/G]
AGTAGAAATCAGGAGTCCAGAAGTCTTCGGAAGAGTTCGGGTATGGCTCTAGTAGCTTTTCTCTTCTCTTTTGTAAGCTTTGTACTTTTATTAGAATACT

Reverse complement sequence

AGTATTCTAATAAAAGTACAAAGCTTACAAAAGAGAAGAGAAAAGCTACTAGAGCCATACCCGAACTCTTCCGAAGACTTCTGGACTCCTGATTTCTACT[T/C]
TATTTCTATTCCACCAACTAGATACTACTAAACTAAACTTGAGATAAATGAGAGAGCTATTGCTTGAGGTGTGTGAGTGAAGTGAGGATGAGAACTCCTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.40%	40.60%	10.98%	2.03%	NA
All Indica	2759	10.30%	67.90%	18.45%	3.37%	NA
All Japonica	1512	99.50%	0.30%	0.13%	0.00%	NA
Aus	269	93.70%	5.60%	0.74%	0.00%	NA
Indica I	595	3.70%	66.90%	21.18%	8.24%	NA
Indica II	465	23.00%	55.10%	19.78%	2.15%	NA
Indica III	913	4.90%	78.40%	15.33%	1.31%	NA
Indica Intermediate	786	14.00%	64.00%	19.21%	2.80%	NA
Temperate Japonica	767	99.30%	0.40%	0.26%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	65.60%	24.40%	6.67%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0525568162	A -> DEL	N	N	silent_mutation	Average:30.361; most accessible tissue: Minghui63 young leaf, score: 45.896	N	N	N	N
vg0525568162	A -> G	LOC_Os05g43930.1	downstream_gene_variant ; 1934.0bp to feature; MODIFIER	silent_mutation	Average:30.361; most accessible tissue: Minghui63 young leaf, score: 45.896	N	N	N	N
vg0525568162	A -> G	LOC_Os05g43940.1	downstream_gene_variant ; 925.0bp to feature; MODIFIER	silent_mutation	Average:30.361; most accessible tissue: Minghui63 young leaf, score: 45.896	N	N	N	N
vg0525568162	A -> G	LOC_Os05g43930-LOC_Os05g43940	intergenic_region ; MODIFIER	silent_mutation	Average:30.361; most accessible tissue: Minghui63 young leaf, score: 45.896	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0525568162	NA	7.68E-54	mr1109	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	NA	3.40E-35	mr1129	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	NA	1.18E-17	mr1255	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	NA	2.20E-15	mr1261	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	NA	1.28E-07	mr1610	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	NA	4.86E-10	mr1896	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	NA	1.19E-08	mr1903	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	NA	6.78E-12	mr1907	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	NA	2.09E-12	mr1914	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	NA	2.19E-10	mr1934	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	NA	6.84E-10	mr1935	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	2.18E-06	NA	mr1093_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	2.05E-06	NA	mr1098_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	4.07E-08	4.61E-69	mr1109_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	1.05E-07	3.12E-11	mr1109_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	NA	1.51E-37	mr1129_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	7.64E-07	NA	mr1174_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	NA	7.02E-19	mr1195_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	NA	5.91E-26	mr1253_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	NA	4.69E-07	mr1253_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	NA	1.39E-20	mr1255_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	NA	3.92E-34	mr1257_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	NA	3.23E-23	mr1316_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	NA	4.66E-11	mr1349_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	NA	4.12E-07	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	NA	1.77E-06	mr1391_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	NA	1.36E-16	mr1457_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	4.78E-06	NA	mr1599_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	3.50E-06	NA	mr1599_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	3.78E-06	3.04E-09	mr1612_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	NA	4.12E-06	mr1612_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	NA	8.16E-12	mr1666_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	2.76E-06	NA	mr1790_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	8.26E-07	NA	mr1828_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	1.69E-07	2.35E-11	mr1828_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	NA	4.43E-06	mr1896_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	NA	5.50E-12	mr1907_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	NA	1.09E-06	mr1910_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	NA	5.27E-29	mr1932_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	NA	8.64E-10	mr1934_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	NA	5.29E-16	mr1938_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525568162	NA	7.04E-07	mr1938_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251