\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0525567832:

Variant ID: vg0525567832 (JBrowse)Variation Type: INDEL
Chromosome: chr05Position: 25567832
Reference Allele: TAAGAACTCAGAlternative Allele: CAAGAACTCAG,T
Primary Allele: CAAGAACTCAGSecondary Allele: TAAGAACTCAG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTTTGTAGAGAATAACACTAAAGTGAAGGAGAATTGACATCAACATAGAAGATAAATCAATCGGATGATGTCGAGAACCAGACTTATGTATGAATGGGC[TAAGAACTCAG/CAAGAACTCAG,T]
AATTGACATGACAAACTGGGCCAAAATTCACAAGTCTACAGAGAAAAACAACGAAGGAGGCCACCAGCCGAAATTGGGCTGGATTGGGCCGGCCCTAGGT

Reverse complement sequence

ACCTAGGGCCGGCCCAATCCAGCCCAATTTCGGCTGGTGGCCTCCTTCGTTGTTTTTCTCTGTAGACTTGTGAATTTTGGCCCAGTTTGTCATGTCAATT[CTGAGTTCTTA/CTGAGTTCTTG,A]
GCCCATTCATACATAAGTCTGGTTCTCGACATCATCCGATTGATTTATCTTCTATGTTGATGTCAATTCTCCTTCACTTTAGTGTTATTCTCTACAAAAT

Allele Frequencies:

Populations Population SizeFrequency of CAAGAACTCAG(primary allele) Frequency of TAAGAACTCAG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.80% 45.50% 0.08% 0.00% T: 0.57%
All Indica  2759 90.00% 9.00% 0.11% 0.00% T: 0.94%
All Japonica  1512 0.50% 99.50% 0.00% 0.00% T: 0.07%
Aus  269 6.70% 93.30% 0.00% 0.00% NA
Indica I  595 98.20% 1.80% 0.00% 0.00% NA
Indica II  465 77.00% 22.60% 0.22% 0.00% T: 0.22%
Indica III  913 93.20% 4.10% 0.00% 0.00% T: 2.74%
Indica Intermediate  786 87.70% 12.10% 0.25% 0.00% NA
Temperate Japonica  767 0.80% 99.20% 0.00% 0.00% NA
Tropical Japonica  504 0.20% 99.60% 0.00% 0.00% T: 0.20%
Japonica Intermediate  241 0.00% 100.00% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 37.80% 61.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0525567832 TAAGAACTCAG -> CAAGAACTCAG LOC_Os05g43930.1 downstream_gene_variant ; 1604.0bp to feature; MODIFIER silent_mutation Average:29.086; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0525567832 TAAGAACTCAG -> CAAGAACTCAG LOC_Os05g43940.1 downstream_gene_variant ; 1255.0bp to feature; MODIFIER silent_mutation Average:29.086; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0525567832 TAAGAACTCAG -> CAAGAACTCAG LOC_Os05g43930-LOC_Os05g43940 intergenic_region ; MODIFIER silent_mutation Average:29.086; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0525567832 TAAGAACTCAG -> T LOC_Os05g43930.1 downstream_gene_variant ; 1605.0bp to feature; MODIFIER silent_mutation Average:29.086; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0525567832 TAAGAACTCAG -> T LOC_Os05g43940.1 downstream_gene_variant ; 1254.0bp to feature; MODIFIER silent_mutation Average:29.086; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0525567832 TAAGAACTCAG -> T LOC_Os05g43930-LOC_Os05g43940 intergenic_region ; MODIFIER silent_mutation Average:29.086; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0525567832 NA 8.59E-13 mr1147_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525567832 NA 8.76E-06 mr1348_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525567832 NA 7.24E-10 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525567832 NA 3.57E-06 mr1391_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525567832 NA 1.23E-06 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525567832 NA 3.85E-33 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525567832 NA 2.81E-09 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525567832 NA 4.69E-10 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525567832 NA 3.35E-06 mr1779_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525567832 1.93E-06 NA mr1790_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525567832 8.01E-06 5.22E-08 mr1828_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525567832 NA 1.60E-14 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525567832 1.02E-06 1.02E-06 mr1992_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251