Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0525567832:

Variant ID: vg0525567832 (JBrowse)	Variation Type: INDEL
Chromosome: chr05	Position: 25567832
Reference Allele: TAAGAACTCAG	Alternative Allele: CAAGAACTCAG,T
Primary Allele: CAAGAACTCAG	Secondary Allele: TAAGAACTCAG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTTTGTAGAGAATAACACTAAAGTGAAGGAGAATTGACATCAACATAGAAGATAAATCAATCGGATGATGTCGAGAACCAGACTTATGTATGAATGGGC[TAAGAACTCAG/CAAGAACTCAG,T]
AATTGACATGACAAACTGGGCCAAAATTCACAAGTCTACAGAGAAAAACAACGAAGGAGGCCACCAGCCGAAATTGGGCTGGATTGGGCCGGCCCTAGGT

Reverse complement sequence

ACCTAGGGCCGGCCCAATCCAGCCCAATTTCGGCTGGTGGCCTCCTTCGTTGTTTTTCTCTGTAGACTTGTGAATTTTGGCCCAGTTTGTCATGTCAATT[CTGAGTTCTTA/CTGAGTTCTTG,A]
GCCCATTCATACATAAGTCTGGTTCTCGACATCATCCGATTGATTTATCTTCTATGTTGATGTCAATTCTCCTTCACTTTAGTGTTATTCTCTACAAAAT

Allele Frequencies:

Populations	Population Size	Frequency of CAAGAACTCAG(primary allele)	Frequency of TAAGAACTCAG(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.80%	45.50%	0.08%	0.00%	T: 0.57%
All Indica	2759	90.00%	9.00%	0.11%	0.00%	T: 0.94%
All Japonica	1512	0.50%	99.50%	0.00%	0.00%	T: 0.07%
Aus	269	6.70%	93.30%	0.00%	0.00%	NA
Indica I	595	98.20%	1.80%	0.00%	0.00%	NA
Indica II	465	77.00%	22.60%	0.22%	0.00%	T: 0.22%
Indica III	913	93.20%	4.10%	0.00%	0.00%	T: 2.74%
Indica Intermediate	786	87.70%	12.10%	0.25%	0.00%	NA
Temperate Japonica	767	0.80%	99.20%	0.00%	0.00%	NA
Tropical Japonica	504	0.20%	99.60%	0.00%	0.00%	T: 0.20%
Japonica Intermediate	241	0.00%	100.00%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	37.80%	61.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0525567832	TAAGAACTCAG -> CAAGAACTCAG	LOC_Os05g43930.1	downstream_gene_variant ; 1604.0bp to feature; MODIFIER	silent_mutation	Average:29.086; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0525567832	TAAGAACTCAG -> CAAGAACTCAG	LOC_Os05g43940.1	downstream_gene_variant ; 1255.0bp to feature; MODIFIER	silent_mutation	Average:29.086; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0525567832	TAAGAACTCAG -> CAAGAACTCAG	LOC_Os05g43930-LOC_Os05g43940	intergenic_region ; MODIFIER	silent_mutation	Average:29.086; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0525567832	TAAGAACTCAG -> T	LOC_Os05g43930.1	downstream_gene_variant ; 1605.0bp to feature; MODIFIER	silent_mutation	Average:29.086; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0525567832	TAAGAACTCAG -> T	LOC_Os05g43940.1	downstream_gene_variant ; 1254.0bp to feature; MODIFIER	silent_mutation	Average:29.086; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0525567832	TAAGAACTCAG -> T	LOC_Os05g43930-LOC_Os05g43940	intergenic_region ; MODIFIER	silent_mutation	Average:29.086; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0525567832	NA	8.59E-13	mr1147_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525567832	NA	8.76E-06	mr1348_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525567832	NA	7.24E-10	mr1349_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525567832	NA	3.57E-06	mr1391_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525567832	NA	1.23E-06	mr1568_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525567832	NA	3.85E-33	mr1598_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525567832	NA	2.81E-09	mr1612_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525567832	NA	4.69E-10	mr1649_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525567832	NA	3.35E-06	mr1779_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525567832	1.93E-06	NA	mr1790_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525567832	8.01E-06	5.22E-08	mr1828_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525567832	NA	1.60E-14	mr1938_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525567832	1.02E-06	1.02E-06	mr1992_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251