\
| Variant ID: vg0525567832 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr05 | Position: 25567832 |
| Reference Allele: TAAGAACTCAG | Alternative Allele: CAAGAACTCAG,T |
| Primary Allele: CAAGAACTCAG | Secondary Allele: TAAGAACTCAG |
Inferred Ancestral Allele: Not determined.
ATTTTGTAGAGAATAACACTAAAGTGAAGGAGAATTGACATCAACATAGAAGATAAATCAATCGGATGATGTCGAGAACCAGACTTATGTATGAATGGGC[TAAGAACTCAG/CAAGAACTCAG,T]
AATTGACATGACAAACTGGGCCAAAATTCACAAGTCTACAGAGAAAAACAACGAAGGAGGCCACCAGCCGAAATTGGGCTGGATTGGGCCGGCCCTAGGT
ACCTAGGGCCGGCCCAATCCAGCCCAATTTCGGCTGGTGGCCTCCTTCGTTGTTTTTCTCTGTAGACTTGTGAATTTTGGCCCAGTTTGTCATGTCAATT[CTGAGTTCTTA/CTGAGTTCTTG,A]
GCCCATTCATACATAAGTCTGGTTCTCGACATCATCCGATTGATTTATCTTCTATGTTGATGTCAATTCTCCTTCACTTTAGTGTTATTCTCTACAAAAT
| Populations | Population Size | Frequency of CAAGAACTCAG(primary allele) | Frequency of TAAGAACTCAG(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.80% | 45.50% | 0.08% | 0.00% | T: 0.57% |
| All Indica | 2759 | 90.00% | 9.00% | 0.11% | 0.00% | T: 0.94% |
| All Japonica | 1512 | 0.50% | 99.50% | 0.00% | 0.00% | T: 0.07% |
| Aus | 269 | 6.70% | 93.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 77.00% | 22.60% | 0.22% | 0.00% | T: 0.22% |
| Indica III | 913 | 93.20% | 4.10% | 0.00% | 0.00% | T: 2.74% |
| Indica Intermediate | 786 | 87.70% | 12.10% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.20% | 99.60% | 0.00% | 0.00% | T: 0.20% |
| Japonica Intermediate | 241 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 37.80% | 61.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0525567832 | TAAGAACTCAG -> CAAGAACTCAG | LOC_Os05g43930.1 | downstream_gene_variant ; 1604.0bp to feature; MODIFIER | silent_mutation | Average:29.086; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0525567832 | TAAGAACTCAG -> CAAGAACTCAG | LOC_Os05g43940.1 | downstream_gene_variant ; 1255.0bp to feature; MODIFIER | silent_mutation | Average:29.086; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0525567832 | TAAGAACTCAG -> CAAGAACTCAG | LOC_Os05g43930-LOC_Os05g43940 | intergenic_region ; MODIFIER | silent_mutation | Average:29.086; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0525567832 | TAAGAACTCAG -> T | LOC_Os05g43930.1 | downstream_gene_variant ; 1605.0bp to feature; MODIFIER | silent_mutation | Average:29.086; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0525567832 | TAAGAACTCAG -> T | LOC_Os05g43940.1 | downstream_gene_variant ; 1254.0bp to feature; MODIFIER | silent_mutation | Average:29.086; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0525567832 | TAAGAACTCAG -> T | LOC_Os05g43930-LOC_Os05g43940 | intergenic_region ; MODIFIER | silent_mutation | Average:29.086; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0525567832 | NA | 8.59E-13 | mr1147_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525567832 | NA | 8.76E-06 | mr1348_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525567832 | NA | 7.24E-10 | mr1349_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525567832 | NA | 3.57E-06 | mr1391_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525567832 | NA | 1.23E-06 | mr1568_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525567832 | NA | 3.85E-33 | mr1598_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525567832 | NA | 2.81E-09 | mr1612_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525567832 | NA | 4.69E-10 | mr1649_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525567832 | NA | 3.35E-06 | mr1779_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525567832 | 1.93E-06 | NA | mr1790_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525567832 | 8.01E-06 | 5.22E-08 | mr1828_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525567832 | NA | 1.60E-14 | mr1938_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525567832 | 1.02E-06 | 1.02E-06 | mr1992_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |