\
| Variant ID: vg0525550165 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 25550165 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 94. )
ATAGGTGGGACCAAGTATTAATAGTTTAGTATATGTTTATAGATAACTATTGTATTGTCGACGAGAAAATCAAACACACCGGCCTGGGAGATCTGCTTAG[C/T]
TCTTGTGCAGGTCCAAATCTTGATGAGATGCGGACGTGCCAGTCAGTTTGATCCTGCAACTGACAAGATATGCAAATATTACATCAAAACAGCCGATCGG
CCGATCGGCTGTTTTGATGTAATATTTGCATATCTTGTCAGTTGCAGGATCAAACTGACTGGCACGTCCGCATCTCATCAAGATTTGGACCTGCACAAGA[G/A]
CTAAGCAGATCTCCCAGGCCGGTGTGTTTGATTTTCTCGTCGACAATACAATAGTTATCTATAAACATATACTAAACTATTAATACTTGGTCCCACCTAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.50% | 7.00% | 3.49% | 0.00% | NA |
| All Indica | 2759 | 82.60% | 11.60% | 5.80% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 75.50% | 11.80% | 12.77% | 0.00% | NA |
| Indica II | 465 | 61.70% | 29.90% | 8.39% | 0.00% | NA |
| Indica III | 913 | 98.80% | 0.80% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 81.60% | 13.20% | 5.22% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 5.60% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0525550165 | C -> T | LOC_Os05g43910.1 | downstream_gene_variant ; 3755.0bp to feature; MODIFIER | silent_mutation | Average:28.964; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0525550165 | C -> T | LOC_Os05g43910-LOC_Os05g43920 | intergenic_region ; MODIFIER | silent_mutation | Average:28.964; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0525550165 | NA | 1.27E-07 | mr1235_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525550165 | NA | 1.61E-07 | mr1243_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525550165 | NA | 1.85E-06 | mr1248_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525550165 | NA | 1.20E-06 | mr1250_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525550165 | 7.78E-06 | 7.79E-06 | mr1259_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525550165 | 3.86E-06 | 3.86E-06 | mr1259_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525550165 | 1.55E-06 | NA | mr1289_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525550165 | 8.54E-08 | 8.54E-08 | mr1289_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525550165 | NA | 2.24E-06 | mr1377_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525550165 | NA | 1.72E-08 | mr1449_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525550165 | NA | 7.28E-06 | mr1449_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525550165 | 4.48E-06 | NA | mr1483_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525550165 | 1.82E-06 | 2.00E-06 | mr1483_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525550165 | NA | 1.64E-08 | mr1498_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525550165 | NA | 8.02E-06 | mr1504_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525550165 | NA | 4.24E-07 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525550165 | 8.13E-06 | 8.13E-06 | mr1575_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525550165 | 8.73E-06 | 8.73E-06 | mr1869_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525550165 | NA | 4.55E-07 | mr1925_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525550165 | NA | 6.39E-07 | mr1931_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525550165 | NA | 3.51E-07 | mr1931_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525550165 | 3.77E-06 | NA | mr1943_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525550165 | 4.41E-06 | 1.11E-07 | mr1943_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |