\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0525542114:

Variant ID: vg0525542114 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 25542114
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.73, T: 0.28, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


CTCACCTCTTGCCCTCAACCACAAAATCAGGTATATTGCCTCCCTCAAATAATAAAACCAGTACAAACGTCTCCCTCGATGATTTTTAACAGTAGTTTTA[C/T]
TGACATGGCAGCCTAATCATCGAAAAAAATAAAATATATACGTGGAGGCCACATGTAAGTGACACTTGCCTTCTTCCTCCACCACTCCCCTCTCTCCTCT

Reverse complement sequence

AGAGGAGAGAGGGGAGTGGTGGAGGAAGAAGGCAAGTGTCACTTACATGTGGCCTCCACGTATATATTTTATTTTTTTCGATGATTAGGCTGCCATGTCA[G/A]
TAAAACTACTGTTAAAAATCATCGAGGGAGACGTTTGTACTGGTTTTATTATTTGAGGGAGGCAATATACCTGATTTTGTGGTTGAGGGCAAGAGGTGAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.80% 18.80% 5.06% 22.41% NA
All Indica  2759 89.90% 1.70% 1.01% 7.36% NA
All Japonica  1512 0.50% 48.30% 13.49% 37.63% NA
Aus  269 5.90% 0.70% 0.00% 93.31% NA
Indica I  595 99.70% 0.00% 0.00% 0.34% NA
Indica II  465 75.10% 2.40% 3.87% 18.71% NA
Indica III  913 93.90% 3.20% 0.00% 2.96% NA
Indica Intermediate  786 86.80% 0.90% 1.27% 11.07% NA
Temperate Japonica  767 0.80% 70.70% 14.86% 13.69% NA
Tropical Japonica  504 0.40% 17.70% 14.29% 67.66% NA
Japonica Intermediate  241 0.00% 41.50% 7.47% 51.04% NA
VI/Aromatic  96 2.10% 84.40% 0.00% 13.54% NA
Intermediate  90 37.80% 28.90% 7.78% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0525542114 C -> T LOC_Os05g43910.1 upstream_gene_variant ; 1108.0bp to feature; MODIFIER silent_mutation Average:95.944; most accessible tissue: Zhenshan97 root, score: 97.676 N N N N
vg0525542114 C -> T LOC_Os05g43900.1 downstream_gene_variant ; 2967.0bp to feature; MODIFIER silent_mutation Average:95.944; most accessible tissue: Zhenshan97 root, score: 97.676 N N N N
vg0525542114 C -> T LOC_Os05g43900-LOC_Os05g43910 intergenic_region ; MODIFIER silent_mutation Average:95.944; most accessible tissue: Zhenshan97 root, score: 97.676 N N N N
vg0525542114 C -> DEL N N silent_mutation Average:95.944; most accessible tissue: Zhenshan97 root, score: 97.676 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0525542114 C T 0.0 0.0 -0.01 0.0 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0525542114 NA 3.40E-13 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0525542114 NA 4.21E-13 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0525542114 NA 2.07E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525542114 NA 7.21E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525542114 NA 4.98E-09 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525542114 NA 2.28E-07 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525542114 NA 7.81E-07 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525542114 NA 6.18E-06 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525542114 1.10E-06 1.10E-06 mr1162_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525542114 NA 3.60E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525542114 NA 2.41E-07 mr1295_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525542114 NA 1.79E-10 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525542114 9.62E-07 NA mr1331_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525542114 3.72E-06 NA mr1358_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525542114 NA 9.84E-06 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525542114 NA 3.64E-07 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525542114 NA 8.05E-07 mr1446_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525542114 NA 3.10E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525542114 NA 1.05E-10 mr1454_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525542114 NA 3.19E-06 mr1576_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525542114 NA 4.46E-11 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525542114 NA 6.01E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525542114 NA 5.74E-08 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525542114 NA 8.03E-10 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525542114 3.34E-06 NA mr1712_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525542114 NA 1.92E-08 mr1746_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525542114 NA 1.72E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525542114 NA 7.78E-06 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525542114 NA 8.56E-16 mr1790_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525542114 NA 1.04E-11 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525542114 NA 1.48E-10 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525542114 NA 3.54E-08 mr1879_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525542114 NA 3.83E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525542114 2.25E-06 2.25E-06 mr1919_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251