Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0525530135:

Variant ID: vg0525530135 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 25530135
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGCATGCTCGCCGCCCAATCACACATCCACCCAACTCCGATGCAGGGGCGGATTCAGAAAAAAAAAATTAGAGGGCTTAATTATACAGTTTCTTCAACCT[T/C]
CAGCCATTTAGGGACCTTTAATTTATTATTTATGGTGAAAAAATTGAAATGGGTGCTTCGGGGGTATCCATAGATCTTGTGGGTGGAGGGGGACTCGAGT

Reverse complement sequence

ACTCGAGTCCCCCTCCACCCACAAGATCTATGGATACCCCCGAAGCACCCATTTCAATTTTTTCACCATAAATAATAAATTAAAGGTCCCTAAATGGCTG[A/G]
AGGTTGAAGAAACTGTATAATTAAGCCCTCTAATTTTTTTTTTCTGAATCCGCCCCTGCATCGGAGTTGGGTGGATGTGTGATTGGGCGGCGAGCATGCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.40%	24.50%	4.00%	6.07%	NA
All Indica	2759	82.70%	0.80%	6.42%	10.15%	NA
All Japonica	1512	31.80%	68.10%	0.13%	0.00%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	76.30%	0.20%	16.81%	6.72%	NA
Indica II	465	84.50%	2.40%	4.52%	8.60%	NA
Indica III	913	83.40%	0.30%	1.20%	15.12%	NA
Indica Intermediate	786	85.60%	0.80%	5.73%	7.89%	NA
Temperate Japonica	767	18.30%	81.70%	0.00%	0.00%	NA
Tropical Japonica	504	58.30%	41.50%	0.20%	0.00%	NA
Japonica Intermediate	241	19.50%	80.10%	0.41%	0.00%	NA
VI/Aromatic	96	15.60%	84.40%	0.00%	0.00%	NA
Intermediate	90	50.00%	32.20%	11.11%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0525530135	T -> DEL	N	N	silent_mutation	Average:67.793; most accessible tissue: Minghui63 root, score: 93.736	N	N	N	N
vg0525530135	T -> C	LOC_Os05g43895.1	upstream_gene_variant ; 696.0bp to feature; MODIFIER	silent_mutation	Average:67.793; most accessible tissue: Minghui63 root, score: 93.736	N	N	N	N
vg0525530135	T -> C	LOC_Os05g43890.1	downstream_gene_variant ; 2873.0bp to feature; MODIFIER	silent_mutation	Average:67.793; most accessible tissue: Minghui63 root, score: 93.736	N	N	N	N
vg0525530135	T -> C	LOC_Os05g43890-LOC_Os05g43895	intergenic_region ; MODIFIER	silent_mutation	Average:67.793; most accessible tissue: Minghui63 root, score: 93.736	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0525530135	T	C	0.0	0.02	0.01	0.0	0.02	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0525530135	NA	4.99E-06	mr1029	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525530135	NA	5.70E-06	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525530135	NA	7.18E-07	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525530135	NA	6.04E-06	mr1725	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525530135	NA	1.23E-07	mr1446_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525530135	1.40E-06	2.21E-08	mr1749_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525530135	NA	8.57E-16	mr1790_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525530135	3.66E-06	8.28E-09	mr1821_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251