\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0525530135:

Variant ID: vg0525530135 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 25530135
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCATGCTCGCCGCCCAATCACACATCCACCCAACTCCGATGCAGGGGCGGATTCAGAAAAAAAAAATTAGAGGGCTTAATTATACAGTTTCTTCAACCT[T/C]
CAGCCATTTAGGGACCTTTAATTTATTATTTATGGTGAAAAAATTGAAATGGGTGCTTCGGGGGTATCCATAGATCTTGTGGGTGGAGGGGGACTCGAGT

Reverse complement sequence

ACTCGAGTCCCCCTCCACCCACAAGATCTATGGATACCCCCGAAGCACCCATTTCAATTTTTTCACCATAAATAATAAATTAAAGGTCCCTAAATGGCTG[A/G]
AGGTTGAAGAAACTGTATAATTAAGCCCTCTAATTTTTTTTTTCTGAATCCGCCCCTGCATCGGAGTTGGGTGGATGTGTGATTGGGCGGCGAGCATGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.40% 24.50% 4.00% 6.07% NA
All Indica  2759 82.70% 0.80% 6.42% 10.15% NA
All Japonica  1512 31.80% 68.10% 0.13% 0.00% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 76.30% 0.20% 16.81% 6.72% NA
Indica II  465 84.50% 2.40% 4.52% 8.60% NA
Indica III  913 83.40% 0.30% 1.20% 15.12% NA
Indica Intermediate  786 85.60% 0.80% 5.73% 7.89% NA
Temperate Japonica  767 18.30% 81.70% 0.00% 0.00% NA
Tropical Japonica  504 58.30% 41.50% 0.20% 0.00% NA
Japonica Intermediate  241 19.50% 80.10% 0.41% 0.00% NA
VI/Aromatic  96 15.60% 84.40% 0.00% 0.00% NA
Intermediate  90 50.00% 32.20% 11.11% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0525530135 T -> DEL N N silent_mutation Average:67.793; most accessible tissue: Minghui63 root, score: 93.736 N N N N
vg0525530135 T -> C LOC_Os05g43895.1 upstream_gene_variant ; 696.0bp to feature; MODIFIER silent_mutation Average:67.793; most accessible tissue: Minghui63 root, score: 93.736 N N N N
vg0525530135 T -> C LOC_Os05g43890.1 downstream_gene_variant ; 2873.0bp to feature; MODIFIER silent_mutation Average:67.793; most accessible tissue: Minghui63 root, score: 93.736 N N N N
vg0525530135 T -> C LOC_Os05g43890-LOC_Os05g43895 intergenic_region ; MODIFIER silent_mutation Average:67.793; most accessible tissue: Minghui63 root, score: 93.736 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0525530135 T C 0.0 0.02 0.01 0.0 0.02 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0525530135 NA 4.99E-06 mr1029 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525530135 NA 5.70E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525530135 NA 7.18E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525530135 NA 6.04E-06 mr1725 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525530135 NA 1.23E-07 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525530135 1.40E-06 2.21E-08 mr1749_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525530135 NA 8.57E-16 mr1790_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525530135 3.66E-06 8.28E-09 mr1821_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251