\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0525522370:

Variant ID: vg0525522370 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 25522370
Reference Allele: TAlternative Allele: A,C
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.01, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


CAATAAAGAAGGGCGGCAGCGGACGAGCCGTAGAGGAGTACAGTGATATAGTCGCTGACGTTTTGGCGGAACTTCTAGAAAGTAAAAAAATAAACCTAAA[T/A,C]
GATAATTAAGTTCGATTTTTAAAATAGCAATGACAATAAAGAGAAGATGCGGTGGACGGTTGTAGAGGAGTATAATGGCAACGTTTGACGGGACTTCTAG

Reverse complement sequence

CTAGAAGTCCCGTCAAACGTTGCCATTATACTCCTCTACAACCGTCCACCGCATCTTCTCTTTATTGTCATTGCTATTTTAAAAATCGAACTTAATTATC[A/T,G]
TTTAGGTTTATTTTTTTACTTTCTAGAAGTTCCGCCAAAACGTCAGCGACTATATCACTGTACTCCTCTACGGCTCGTCCGCTGCCGCCCTTCTTTATTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.20% 47.80% 0.06% 0.00% NA
All Indica  2759 87.60% 12.30% 0.11% 0.00% NA
All Japonica  1512 0.60% 99.40% 0.00% 0.00% NA
Aus  269 2.20% 97.80% 0.00% 0.00% NA
Indica I  595 98.50% 1.20% 0.34% 0.00% NA
Indica II  465 72.00% 28.00% 0.00% 0.00% NA
Indica III  913 92.20% 7.80% 0.00% 0.00% NA
Indica Intermediate  786 83.10% 16.80% 0.13% 0.00% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 0.20% 99.80% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 35.60% 64.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0525522370 T -> C LOC_Os05g43890.1 upstream_gene_variant ; 4540.0bp to feature; MODIFIER N Average:27.775; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0525522370 T -> C LOC_Os05g43880-LOC_Os05g43890 intergenic_region ; MODIFIER N Average:27.775; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0525522370 T -> A LOC_Os05g43890.1 upstream_gene_variant ; 4540.0bp to feature; MODIFIER silent_mutation Average:27.775; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0525522370 T -> A LOC_Os05g43880-LOC_Os05g43890 intergenic_region ; MODIFIER silent_mutation Average:27.775; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0525522370 NA 1.56E-14 mr1032 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525522370 NA 2.78E-15 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525522370 NA 1.56E-14 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525522370 NA 3.89E-14 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525522370 NA 1.25E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525522370 NA 4.67E-08 mr1896 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525522370 NA 1.01E-11 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525522370 2.13E-06 NA mr1935 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525522370 1.50E-06 8.55E-11 mr1935 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525522370 NA 5.47E-12 mr1938 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525522370 NA 1.38E-56 mr1109_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525522370 NA 3.19E-33 mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525522370 NA 3.22E-19 mr1165_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525522370 NA 8.35E-23 mr1253_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525522370 NA 9.12E-09 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525522370 NA 4.85E-09 mr1828_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525522370 NA 2.23E-09 mr1907_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525522370 NA 2.26E-09 mr1934_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525522370 NA 3.01E-14 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251