Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0525522370:

Variant ID: vg0525522370 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 25522370
Reference Allele: T	Alternative Allele: A,C
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.01, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

CAATAAAGAAGGGCGGCAGCGGACGAGCCGTAGAGGAGTACAGTGATATAGTCGCTGACGTTTTGGCGGAACTTCTAGAAAGTAAAAAAATAAACCTAAA[T/A,C]
GATAATTAAGTTCGATTTTTAAAATAGCAATGACAATAAAGAGAAGATGCGGTGGACGGTTGTAGAGGAGTATAATGGCAACGTTTGACGGGACTTCTAG

Reverse complement sequence

CTAGAAGTCCCGTCAAACGTTGCCATTATACTCCTCTACAACCGTCCACCGCATCTTCTCTTTATTGTCATTGCTATTTTAAAAATCGAACTTAATTATC[A/T,G]
TTTAGGTTTATTTTTTTACTTTCTAGAAGTTCCGCCAAAACGTCAGCGACTATATCACTGTACTCCTCTACGGCTCGTCCGCTGCCGCCCTTCTTTATTG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.20%	47.80%	0.06%	0.00%	NA
All Indica	2759	87.60%	12.30%	0.11%	0.00%	NA
All Japonica	1512	0.60%	99.40%	0.00%	0.00%	NA
Aus	269	2.20%	97.80%	0.00%	0.00%	NA
Indica I	595	98.50%	1.20%	0.34%	0.00%	NA
Indica II	465	72.00%	28.00%	0.00%	0.00%	NA
Indica III	913	92.20%	7.80%	0.00%	0.00%	NA
Indica Intermediate	786	83.10%	16.80%	0.13%	0.00%	NA
Temperate Japonica	767	0.90%	99.10%	0.00%	0.00%	NA
Tropical Japonica	504	0.20%	99.80%	0.00%	0.00%	NA
Japonica Intermediate	241	0.40%	99.60%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	35.60%	64.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0525522370	T -> C	LOC_Os05g43890.1	upstream_gene_variant ; 4540.0bp to feature; MODIFIER	N	Average:27.775; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg0525522370	T -> C	LOC_Os05g43880-LOC_Os05g43890	intergenic_region ; MODIFIER	N	Average:27.775; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg0525522370	T -> A	LOC_Os05g43890.1	upstream_gene_variant ; 4540.0bp to feature; MODIFIER	silent_mutation	Average:27.775; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg0525522370	T -> A	LOC_Os05g43880-LOC_Os05g43890	intergenic_region ; MODIFIER	silent_mutation	Average:27.775; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0525522370	NA	1.56E-14	mr1032	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525522370	NA	2.78E-15	mr1165	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525522370	NA	1.56E-14	mr1261	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525522370	NA	3.89E-14	mr1478	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525522370	NA	1.25E-08	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525522370	NA	4.67E-08	mr1896	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525522370	NA	1.01E-11	mr1914	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525522370	2.13E-06	NA	mr1935	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525522370	1.50E-06	8.55E-11	mr1935	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525522370	NA	5.47E-12	mr1938	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525522370	NA	1.38E-56	mr1109_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525522370	NA	3.19E-33	mr1161_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525522370	NA	3.22E-19	mr1165_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525522370	NA	8.35E-23	mr1253_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525522370	NA	9.12E-09	mr1478_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525522370	NA	4.85E-09	mr1828_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525522370	NA	2.23E-09	mr1907_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525522370	NA	2.26E-09	mr1934_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525522370	NA	3.01E-14	mr1938_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251