\
| Variant ID: vg0525520857 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 25520857 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AATCCCTTCTGACATCCGGTCAAACGTCCGATGTGACACCTAAAAATTTTCATTTCGTGAACTAAACGAGGCCTAAAACGTGGTCGGCTCAAGAGTCGTC[C/T]
ACAGTCATGCAGTGAAGACCCATGCAGAACCACAATACTAGCCTAGCATGGGCTCACCTGACAGTGTGTGTAAATATAATAAATATCCCAATCTATCTAT
ATAGATAGATTGGGATATTTATTATATTTACACACACTGTCAGGTGAGCCCATGCTAGGCTAGTATTGTGGTTCTGCATGGGTCTTCACTGCATGACTGT[G/A]
GACGACTCTTGAGCCGACCACGTTTTAGGCCTCGTTTAGTTCACGAAATGAAAATTTTTAGGTGTCACATCGGACGTTTGACCGGATGTCAGAAGGGATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.10% | 4.00% | 4.85% | 0.00% | NA |
| All Indica | 2759 | 85.00% | 6.90% | 8.19% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 61.70% | 14.50% | 23.87% | 0.00% | NA |
| Indica II | 465 | 95.30% | 0.90% | 3.87% | 0.00% | NA |
| Indica III | 913 | 93.80% | 5.30% | 0.99% | 0.00% | NA |
| Indica Intermediate | 786 | 86.30% | 6.50% | 7.25% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 2.20% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0525520857 | C -> T | LOC_Os05g43880.1 | upstream_gene_variant ; 4653.0bp to feature; MODIFIER | silent_mutation | Average:51.386; most accessible tissue: Minghui63 root, score: 62.438 | N | N | N | N |
| vg0525520857 | C -> T | LOC_Os05g43880-LOC_Os05g43890 | intergenic_region ; MODIFIER | silent_mutation | Average:51.386; most accessible tissue: Minghui63 root, score: 62.438 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0525520857 | NA | 8.00E-06 | mr1285 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525520857 | NA | 7.08E-06 | mr1528 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525520857 | NA | 3.44E-09 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525520857 | NA | 5.30E-07 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525520857 | NA | 3.33E-12 | mr1739 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525520857 | NA | 1.29E-09 | mr1739 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525520857 | NA | 2.90E-06 | mr1255_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |