\
| Variant ID: vg0525434049 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 25434049 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TAGGTTTGACTAAGTTTATAGACAAATATAGTAATATTTATAATACTAAATTAGTTTCATCAAATCAATATAATAGAATATATTTTCACAATAAACTAGT[C/A]
TTGCACTGGTGGAGAAACCATCTTTGGTCGGTCGCCCGAAATCCACAATAGTCTCGGTTCCACTAAAAACCGGGACTAAAGATGATCTTTAGTCCCGGTT
AACCGGGACTAAAGATCATCTTTAGTCCCGGTTTTTAGTGGAACCGAGACTATTGTGGATTTCGGGCGACCGACCAAAGATGGTTTCTCCACCAGTGCAA[G/T]
ACTAGTTTATTGTGAAAATATATTCTATTATATTGATTTGATGAAACTAATTTAGTATTATAAATATTACTATATTTGTCTATAAACTTAGTCAAACCTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.70% | 1.10% | 34.28% | 15.95% | NA |
| All Indica | 2759 | 32.40% | 0.00% | 50.38% | 17.22% | NA |
| All Japonica | 1512 | 79.80% | 3.00% | 5.56% | 11.57% | NA |
| Aus | 269 | 21.60% | 0.00% | 44.61% | 33.83% | NA |
| Indica I | 595 | 14.30% | 0.00% | 62.02% | 23.70% | NA |
| Indica II | 465 | 41.10% | 0.20% | 43.44% | 15.27% | NA |
| Indica III | 913 | 39.90% | 0.00% | 45.56% | 14.57% | NA |
| Indica Intermediate | 786 | 32.20% | 0.00% | 51.27% | 16.54% | NA |
| Temperate Japonica | 767 | 86.00% | 0.80% | 3.13% | 10.04% | NA |
| Tropical Japonica | 504 | 81.00% | 3.80% | 8.13% | 7.14% | NA |
| Japonica Intermediate | 241 | 57.70% | 8.70% | 7.88% | 25.73% | NA |
| VI/Aromatic | 96 | 92.70% | 1.00% | 4.17% | 2.08% | NA |
| Intermediate | 90 | 61.10% | 2.20% | 24.44% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0525434049 | C -> DEL | N | N | silent_mutation | Average:25.237; most accessible tissue: Callus, score: 54.863 | N | N | N | N |
| vg0525434049 | C -> A | LOC_Os05g43760.1 | upstream_gene_variant ; 2305.0bp to feature; MODIFIER | silent_mutation | Average:25.237; most accessible tissue: Callus, score: 54.863 | N | N | N | N |
| vg0525434049 | C -> A | LOC_Os05g43750.1 | downstream_gene_variant ; 1522.0bp to feature; MODIFIER | silent_mutation | Average:25.237; most accessible tissue: Callus, score: 54.863 | N | N | N | N |
| vg0525434049 | C -> A | LOC_Os05g43750-LOC_Os05g43760 | intergenic_region ; MODIFIER | silent_mutation | Average:25.237; most accessible tissue: Callus, score: 54.863 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0525434049 | NA | 8.65E-12 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0525434049 | NA | 6.36E-07 | mr1280 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525434049 | NA | 2.99E-07 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525434049 | NA | 3.33E-08 | mr1807 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525434049 | NA | 7.55E-06 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525434049 | 2.25E-06 | 3.42E-10 | mr1947_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |