\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0525434049:

Variant ID: vg0525434049 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 25434049
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGGTTTGACTAAGTTTATAGACAAATATAGTAATATTTATAATACTAAATTAGTTTCATCAAATCAATATAATAGAATATATTTTCACAATAAACTAGT[C/A]
TTGCACTGGTGGAGAAACCATCTTTGGTCGGTCGCCCGAAATCCACAATAGTCTCGGTTCCACTAAAAACCGGGACTAAAGATGATCTTTAGTCCCGGTT

Reverse complement sequence

AACCGGGACTAAAGATCATCTTTAGTCCCGGTTTTTAGTGGAACCGAGACTATTGTGGATTTCGGGCGACCGACCAAAGATGGTTTCTCCACCAGTGCAA[G/T]
ACTAGTTTATTGTGAAAATATATTCTATTATATTGATTTGATGAAACTAATTTAGTATTATAAATATTACTATATTTGTCTATAAACTTAGTCAAACCTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.70% 1.10% 34.28% 15.95% NA
All Indica  2759 32.40% 0.00% 50.38% 17.22% NA
All Japonica  1512 79.80% 3.00% 5.56% 11.57% NA
Aus  269 21.60% 0.00% 44.61% 33.83% NA
Indica I  595 14.30% 0.00% 62.02% 23.70% NA
Indica II  465 41.10% 0.20% 43.44% 15.27% NA
Indica III  913 39.90% 0.00% 45.56% 14.57% NA
Indica Intermediate  786 32.20% 0.00% 51.27% 16.54% NA
Temperate Japonica  767 86.00% 0.80% 3.13% 10.04% NA
Tropical Japonica  504 81.00% 3.80% 8.13% 7.14% NA
Japonica Intermediate  241 57.70% 8.70% 7.88% 25.73% NA
VI/Aromatic  96 92.70% 1.00% 4.17% 2.08% NA
Intermediate  90 61.10% 2.20% 24.44% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0525434049 C -> DEL N N silent_mutation Average:25.237; most accessible tissue: Callus, score: 54.863 N N N N
vg0525434049 C -> A LOC_Os05g43760.1 upstream_gene_variant ; 2305.0bp to feature; MODIFIER silent_mutation Average:25.237; most accessible tissue: Callus, score: 54.863 N N N N
vg0525434049 C -> A LOC_Os05g43750.1 downstream_gene_variant ; 1522.0bp to feature; MODIFIER silent_mutation Average:25.237; most accessible tissue: Callus, score: 54.863 N N N N
vg0525434049 C -> A LOC_Os05g43750-LOC_Os05g43760 intergenic_region ; MODIFIER silent_mutation Average:25.237; most accessible tissue: Callus, score: 54.863 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0525434049 NA 8.65E-12 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0525434049 NA 6.36E-07 mr1280 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525434049 NA 2.99E-07 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525434049 NA 3.33E-08 mr1807 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525434049 NA 7.55E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525434049 2.25E-06 3.42E-10 mr1947_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251