\
| Variant ID: vg0525416226 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 25416226 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTGCTAGCTCGGGGCGTGACACGGTGGCAGGAGGACGGTGCCAGAGAGGCTGGCGCCGTCCCGTTGGATGACGGCGCCAGCCACTCTGGCGCCCCAAAAA[G/T]
AACTATTTCTGGGATAAGTTTTTTCAGAGGTCTATTTGCGAAATAAGTTTTTTAAAAGGACAAAAATGTGAAAAATCCAGATGTTTATTACTACTCCGTA
TACGGAGTAGTAATAAACATCTGGATTTTTCACATTTTTGTCCTTTTAAAAAACTTATTTCGCAAATAGACCTCTGAAAAAACTTATCCCAGAAATAGTT[C/A]
TTTTTGGGGCGCCAGAGTGGCTGGCGCCGTCATCCAACGGGACGGCGCCAGCCTCTCTGGCACCGTCCTCCTGCCACCGTGTCACGCCCCGAGCTAGCAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.40% | 6.60% | 1.04% | 0.00% | NA |
| All Indica | 2759 | 98.20% | 0.10% | 1.67% | 0.00% | NA |
| All Japonica | 1512 | 79.90% | 19.90% | 0.20% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.60% | 0.60% | 1.72% | 0.00% | NA |
| Indica III | 913 | 97.00% | 0.00% | 2.96% | 0.00% | NA |
| Indica Intermediate | 786 | 98.60% | 0.00% | 1.40% | 0.00% | NA |
| Temperate Japonica | 767 | 86.20% | 13.60% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 80.80% | 19.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 58.10% | 41.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0525416226 | G -> T | LOC_Os05g43720.1 | upstream_gene_variant ; 2983.0bp to feature; MODIFIER | silent_mutation | Average:50.497; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0525416226 | G -> T | LOC_Os05g43730.1 | upstream_gene_variant ; 1511.0bp to feature; MODIFIER | silent_mutation | Average:50.497; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0525416226 | G -> T | LOC_Os05g43720-LOC_Os05g43730 | intergenic_region ; MODIFIER | silent_mutation | Average:50.497; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0525416226 | NA | 1.06E-06 | mr1280 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525416226 | NA | 2.80E-07 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525416226 | NA | 2.18E-08 | mr1807 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525416226 | NA | 7.34E-06 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525416226 | 1.04E-07 | NA | mr1842_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525416226 | 6.37E-06 | 7.98E-10 | mr1947_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |