Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0525250031:

Variant ID: vg0525250031 (JBrowse)	Variation Type: INDEL
Chromosome: chr05	Position: 25250031
Reference Allele: CG	Alternative Allele: C
Primary Allele: CG	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGTCGGTGACATGGGACCGGGAGTATCCTGACTAGGGGCTTGGGCAGGAGCAATCACCCACGAGGCCTGACCCCCTCGGGGGAGTCGGGCCCGAGGGTGA[CG/C]
TGGCCGCCCCCCCTCTTCGTCTCCCCGAGGAGTCGGACCACTCCCGCTTCGGCCCCGAGGGCTGAGGCGCCCCGACCCCTTGTGGGTTTGGCGCCGCGTG

Reverse complement sequence

CACGCGGCGCCAAACCCACAAGGGGTCGGGGCGCCTCAGCCCTCGGGGCCGAAGCGGGAGTGGTCCGACTCCTCGGGGAGACGAAGAGGGGGGGCGGCCA[CG/G]
TCACCCTCGGGCCCGACTCCCCCGAGGGGGTCAGGCCTCGTGGGTGATTGCTCCTGCCCAAGCCCCTAGTCAGGATACTCCCGGTCCCATGTCACCGACA

Allele Frequencies:

Populations	Population Size	Frequency of CG(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.30%	1.10%	7.60%	52.05%	NA
All Indica	2759	10.70%	1.80%	10.04%	77.42%	NA
All Japonica	1512	93.80%	0.00%	0.99%	5.22%	NA
Aus	269	1.90%	0.00%	23.79%	74.35%	NA
Indica I	595	1.50%	0.70%	2.86%	94.96%	NA
Indica II	465	31.80%	0.90%	5.81%	61.51%	NA
Indica III	913	6.20%	3.30%	15.01%	75.47%	NA
Indica Intermediate	786	10.40%	1.50%	12.21%	75.83%	NA
Temperate Japonica	767	98.70%	0.00%	0.00%	1.30%	NA
Tropical Japonica	504	85.10%	0.00%	2.78%	12.10%	NA
Japonica Intermediate	241	96.30%	0.00%	0.41%	3.32%	NA
VI/Aromatic	96	90.60%	0.00%	0.00%	9.38%	NA
Intermediate	90	56.70%	0.00%	3.33%	40.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0525250031	CG -> DEL	N	N	silent_mutation	Average:16.49; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0525250031	CG -> C	LOC_Os05g43420.1	upstream_gene_variant ; 683.0bp to feature; MODIFIER	silent_mutation	Average:16.49; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0525250031	CG -> C	LOC_Os05g43410.1	downstream_gene_variant ; 4595.0bp to feature; MODIFIER	silent_mutation	Average:16.49; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0525250031	CG -> C	LOC_Os05g43440.1	downstream_gene_variant ; 4778.0bp to feature; MODIFIER	silent_mutation	Average:16.49; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0525250031	CG -> C	LOC_Os05g43420-LOC_Os05g43440	intergenic_region ; MODIFIER	silent_mutation	Average:16.49; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0525250031	NA	3.88E-22	mr1150	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525250031	NA	3.39E-13	mr1239	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525250031	NA	3.29E-11	mr1272	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525250031	NA	1.45E-10	mr1307	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525250031	NA	4.69E-07	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525250031	NA	2.62E-06	mr1516	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525250031	NA	6.26E-11	mr1553	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525250031	NA	2.13E-06	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525250031	NA	1.40E-10	mr1683	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525250031	NA	5.04E-09	mr1776	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525250031	NA	6.28E-06	mr1835	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525250031	NA	2.43E-26	mr1903	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525250031	NA	8.82E-53	mr1935	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525250031	8.71E-07	8.71E-07	mr1341_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525250031	NA	1.58E-07	mr1828_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525250031	NA	1.07E-10	mr1893_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251