\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0525249866:

Variant ID: vg0525249866 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 25249866
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


ATTGACAGTCGAGTTACCGTTGCCGGAGTGCGTGATTTGCGACCGTTGGGTTTCTGCCCAACTGTGGAGACCGGTCCCACCTGTCACCAGGCTTTGGGAA[G/C]
TGGCGTCACGCCCGACCGCTTCTCTCGAGGAGGGCGATCGCCCTGGCATAACGCCGGGGGCTACTGTCGGTGACATGGGACCGGGAGTATCCTGACTAGG

Reverse complement sequence

CCTAGTCAGGATACTCCCGGTCCCATGTCACCGACAGTAGCCCCCGGCGTTATGCCAGGGCGATCGCCCTCCTCGAGAGAAGCGGTCGGGCGTGACGCCA[C/G]
TTCCCAAAGCCTGGTGACAGGTGGGACCGGTCTCCACAGTTGGGCAGAAACCCAACGGTCGCAAATCACGCACTCCGGCAACGGTAACTCGACTGTCAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.80% 3.80% 19.85% 9.50% NA
All Indica  2759 44.90% 6.50% 32.62% 16.02% NA
All Japonica  1512 99.80% 0.00% 0.13% 0.07% NA
Aus  269 90.30% 0.40% 8.92% 0.37% NA
Indica I  595 19.20% 1.00% 49.08% 30.76% NA
Indica II  465 65.80% 2.80% 24.30% 7.10% NA
Indica III  913 48.40% 13.30% 24.86% 13.47% NA
Indica Intermediate  786 47.80% 5.00% 34.10% 13.10% NA
Temperate Japonica  767 99.70% 0.00% 0.13% 0.13% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 82.20% 0.00% 12.22% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0525249866 G -> DEL N N silent_mutation Average:31.68; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0525249866 G -> C LOC_Os05g43420.1 upstream_gene_variant ; 517.0bp to feature; MODIFIER silent_mutation Average:31.68; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0525249866 G -> C LOC_Os05g43410.1 downstream_gene_variant ; 4429.0bp to feature; MODIFIER silent_mutation Average:31.68; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0525249866 G -> C LOC_Os05g43440.1 downstream_gene_variant ; 4944.0bp to feature; MODIFIER silent_mutation Average:31.68; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0525249866 G -> C LOC_Os05g43420-LOC_Os05g43440 intergenic_region ; MODIFIER silent_mutation Average:31.68; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0525249866 1.80E-06 2.88E-09 mr1841 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525249866 1.61E-07 1.61E-07 mr1900 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525249866 NA 4.40E-06 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525249866 NA 5.84E-07 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525249866 NA 7.37E-06 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251