\
| Variant ID: vg0525249866 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 25249866 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 186. )
ATTGACAGTCGAGTTACCGTTGCCGGAGTGCGTGATTTGCGACCGTTGGGTTTCTGCCCAACTGTGGAGACCGGTCCCACCTGTCACCAGGCTTTGGGAA[G/C]
TGGCGTCACGCCCGACCGCTTCTCTCGAGGAGGGCGATCGCCCTGGCATAACGCCGGGGGCTACTGTCGGTGACATGGGACCGGGAGTATCCTGACTAGG
CCTAGTCAGGATACTCCCGGTCCCATGTCACCGACAGTAGCCCCCGGCGTTATGCCAGGGCGATCGCCCTCCTCGAGAGAAGCGGTCGGGCGTGACGCCA[C/G]
TTCCCAAAGCCTGGTGACAGGTGGGACCGGTCTCCACAGTTGGGCAGAAACCCAACGGTCGCAAATCACGCACTCCGGCAACGGTAACTCGACTGTCAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.80% | 3.80% | 19.85% | 9.50% | NA |
| All Indica | 2759 | 44.90% | 6.50% | 32.62% | 16.02% | NA |
| All Japonica | 1512 | 99.80% | 0.00% | 0.13% | 0.07% | NA |
| Aus | 269 | 90.30% | 0.40% | 8.92% | 0.37% | NA |
| Indica I | 595 | 19.20% | 1.00% | 49.08% | 30.76% | NA |
| Indica II | 465 | 65.80% | 2.80% | 24.30% | 7.10% | NA |
| Indica III | 913 | 48.40% | 13.30% | 24.86% | 13.47% | NA |
| Indica Intermediate | 786 | 47.80% | 5.00% | 34.10% | 13.10% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 0.00% | 12.22% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0525249866 | G -> DEL | N | N | silent_mutation | Average:31.68; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0525249866 | G -> C | LOC_Os05g43420.1 | upstream_gene_variant ; 517.0bp to feature; MODIFIER | silent_mutation | Average:31.68; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0525249866 | G -> C | LOC_Os05g43410.1 | downstream_gene_variant ; 4429.0bp to feature; MODIFIER | silent_mutation | Average:31.68; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0525249866 | G -> C | LOC_Os05g43440.1 | downstream_gene_variant ; 4944.0bp to feature; MODIFIER | silent_mutation | Average:31.68; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0525249866 | G -> C | LOC_Os05g43420-LOC_Os05g43440 | intergenic_region ; MODIFIER | silent_mutation | Average:31.68; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0525249866 | 1.80E-06 | 2.88E-09 | mr1841 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525249866 | 1.61E-07 | 1.61E-07 | mr1900 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525249866 | NA | 4.40E-06 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525249866 | NA | 5.84E-07 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525249866 | NA | 7.37E-06 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |