Search for Variation information by Variation ID:
Detailed information for vg0525239875:
| Variant ID: vg0525239875 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 25239875 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
CCGACCCGGGAAGATCTGCGTGGGGGGTCGGATGCCCGCACCAGTATCGAGCGCCGGCGTAATGGCCGACGTGCTGCCCACGCAACGGAGGGCGCCTCCT[C/T]
GTCCGGGGTGTCACCTCAACATGGACGCGGGGATCAGCCCTCCGTGCCCCCGGTTGGTGGTGTCGGCTGTAGAGCCTTTGTGGCGAGCCTTCGGAACGTC
Reverse complement sequence
GACGTTCCGAAGGCTCGCCACAAAGGCTCTACAGCCGACACCACCAACCGGGGGCACGGAGGGCTGATCCCCGCGTCCATGTTGAGGTGACACCCCGGAC[G/A]
AGGAGGCGCCCTCCGTTGCGTGGGCAGCACGTCGGCCATTACGCCGGCGCTCGATACTGGTGCGGGCATCCGACCCCCCACGCAGATCTTCCCGGGTCGG
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.30% | 0.10% | 1.69% | 35.87% | NA |
| All Indica | 2759 | 43.80% | 0.20% | 2.14% | 53.90% | NA |
| All Japonica | 1512 | 95.00% | 0.00% | 0.13% | 4.83% | NA |
| Aus | 269 | 54.60% | 0.00% | 6.69% | 38.66% | NA |
| Indica I | 595 | 20.20% | 0.50% | 2.69% | 76.64% | NA |
| Indica II | 465 | 50.10% | 0.00% | 1.29% | 48.60% | NA |
| Indica III | 913 | 57.60% | 0.00% | 2.08% | 40.31% | NA |
| Indica Intermediate | 786 | 41.90% | 0.30% | 2.29% | 55.60% | NA |
| Temperate Japonica | 767 | 98.70% | 0.00% | 0.13% | 1.17% | NA |
| Tropical Japonica | 504 | 88.70% | 0.00% | 0.00% | 11.31% | NA |
| Japonica Intermediate | 241 | 96.70% | 0.00% | 0.41% | 2.90% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 68.90% | 0.00% | 1.11% | 30.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0525239875 | C -> T | LOC_Os05g43410.1 | missense_variant ; p.Ser198Leu; MODERATE | nonsynonymous_codon ; S198L | Average:15.338; most accessible tissue: Minghui63 panicle, score: 38.588 | benign  |
0.178 |
DELETERIOUS | 0.02 |
| vg0525239875 | C -> DEL | LOC_Os05g43410.1 | N | frameshift_variant | Average:15.338; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0525239875 | 7.87E-06 | NA | mr1067 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525239875 | 1.62E-06 | NA | mr1098 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525239875 | 2.65E-06 | NA | mr1101 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525239875 | 1.09E-06 | NA | mr1101 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525239875 | 2.60E-06 | NA | mr1130 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525239875 | 2.83E-06 | NA | mr1130 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525239875 | 6.69E-06 | NA | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525239875 | 2.15E-06 | NA | mr1868 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525239875 | 2.19E-06 | NA | mr1868 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525239875 | 1.38E-06 | NA | mr1918 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525239875 | 1.36E-06 | NA | mr1918 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |