Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0525124226:

Variant ID: vg0525124226 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 25124226
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 322. )

Flanking Sequence (100 bp) in Reference Genome:


CCTAGCGTAGTTTTGTTTGACTACTACTTTGTGAAATTGCTGTTGTGGAATGGGATCGATGTTTGGAAAATCTGCGGCTGATAGGATCAGCTAGGCCTGG[G/A]
TGGCCATTTGAAAGCTGTTGGCCGGGTGCCAACCTTGATCAATTCAAAGACTGATACACTGCACATACTCCGACCGGACAAGACGCACTGTCTCATTCGT

Reverse complement sequence

ACGAATGAGACAGTGCGTCTTGTCCGGTCGGAGTATGTGCAGTGTATCAGTCTTTGAATTGATCAAGGTTGGCACCCGGCCAACAGCTTTCAAATGGCCA[C/T]
CCAGGCCTAGCTGATCCTATCAGCCGCAGATTTTCCAAACATCGATCCCATTCCACAACAGCAATTTCACAAAGTAGTAGTCAAACAAAACTACGCTAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.10% 1.20% 0.66% 0.00% NA
All Indica  2759 100.00% 0.00% 0.04% 0.00% NA
All Japonica  1512 94.20% 3.80% 1.98% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.00% 0.13% 0.00% NA
Temperate Japonica  767 88.90% 7.40% 3.65% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.00% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0525124226 G -> A LOC_Os05g43210-LOC_Os05g43220 intergenic_region ; MODIFIER silent_mutation Average:36.07; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0525124226 7.01E-07 7.01E-07 mr1166 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525124226 NA 1.19E-09 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525124226 3.80E-06 4.37E-11 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525124226 3.94E-06 3.94E-06 mr1409 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525124226 1.40E-06 6.75E-10 mr1515 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525124226 NA 8.78E-10 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525124226 4.55E-06 2.36E-11 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525124226 2.46E-06 2.46E-06 mr1687 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525124226 NA 4.40E-08 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525124226 NA 1.28E-06 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525124226 NA 3.72E-09 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251