\
| Variant ID: vg0525094756 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 25094756 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 120. )
CGTGGCGCTGAGGTGTCTAAGCTCAGCGCCACATGATTTGGCGTTGAGCAAAAGGGTCAGATTTGAAACAAGTTTTAGCAGCGGTTCATTTGTAAAAATA[G/A]
TTTTTGCAAAGGGTCAAATTGTCAAAATTTGTGCGATGAACATACTGTACTATATTTAACACTTGAGTGGTTGGTTTAGGACTTAAAACACTTGGATGTG
CACATCCAAGTGTTTTAAGTCCTAAACCAACCACTCAAGTGTTAAATATAGTACAGTATGTTCATCGCACAAATTTTGACAATTTGACCCTTTGCAAAAA[C/T]
TATTTTTACAAATGAACCGCTGCTAAAACTTGTTTCAAATCTGACCCTTTTGCTCAACGCCAAATCATGTGGCGCTGAGCTTAGACACCTCAGCGCCACG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.10% | 44.60% | 0.30% | 0.00% | NA |
| All Indica | 2759 | 92.20% | 7.40% | 0.40% | 0.00% | NA |
| All Japonica | 1512 | 1.30% | 98.70% | 0.07% | 0.00% | NA |
| Aus | 269 | 1.90% | 98.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 78.50% | 21.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.80% | 2.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 88.30% | 10.60% | 1.15% | 0.00% | NA |
| Temperate Japonica | 767 | 1.40% | 98.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.40% | 98.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 38.90% | 58.90% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0525094756 | G -> A | LOC_Os05g43190-LOC_Os05g43210 | intergenic_region ; MODIFIER | silent_mutation | Average:48.768; most accessible tissue: Callus, score: 63.967 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0525094756 | NA | 2.40E-34 | mr1026 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | NA | 9.01E-14 | mr1032 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | NA | 5.58E-55 | mr1109 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | NA | 6.99E-34 | mr1129 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | NA | 1.73E-33 | mr1161 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | NA | 1.86E-15 | mr1199 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | NA | 3.92E-17 | mr1253 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | NA | 1.18E-18 | mr1255 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | NA | 3.01E-16 | mr1261 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | NA | 8.51E-11 | mr1316 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | NA | 1.40E-07 | mr1610 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | 2.63E-06 | 2.63E-06 | mr1612 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | NA | 1.15E-08 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | NA | 6.71E-16 | mr1700 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | NA | 8.74E-36 | mr1828 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | NA | 3.14E-12 | mr1883 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | 1.29E-06 | 2.67E-12 | mr1896 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | NA | 3.09E-11 | mr1903 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | NA | 1.36E-13 | mr1907 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | 8.62E-07 | NA | mr1934 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | 3.98E-08 | 1.31E-14 | mr1934 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | 7.40E-07 | 1.35E-13 | mr1935 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | NA | 9.71E-13 | mr1938 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | 6.59E-06 | NA | mr1095_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | NA | 1.69E-66 | mr1109_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | 7.52E-06 | NA | mr1109_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | 2.65E-06 | NA | mr1120_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | NA | 1.26E-12 | mr1147_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | NA | 3.41E-35 | mr1161_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | NA | 4.91E-18 | mr1199_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | NA | 2.46E-24 | mr1253_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | NA | 1.12E-19 | mr1255_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | NA | 4.19E-10 | mr1349_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | NA | 1.82E-33 | mr1598_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | NA | 3.82E-09 | mr1612_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | NA | 3.53E-06 | mr1612_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | NA | 3.25E-09 | mr1649_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | 1.38E-07 | NA | mr1828_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | 2.36E-08 | 5.08E-14 | mr1828_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | NA | 1.56E-09 | mr1889_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | NA | 6.71E-09 | mr1896_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | NA | 1.07E-14 | mr1907_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | NA | 5.48E-29 | mr1932_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | NA | 5.80E-14 | mr1934_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | NA | 7.19E-16 | mr1938_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525094756 | NA | 9.48E-06 | mr1938_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |