\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0525073369:

Variant ID: vg0525073369 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 25073369
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 127. )

Flanking Sequence (100 bp) in Reference Genome:


GACTCACCCGGACCTCCTCACCCAGTTCGCCGTCGATGCCGCCCTCGTCGGGAAGTCCGCCGCGGTGGTCGGAATGAGACAGGAACGGAGACGGTATGAG[A/G]
GAGGAGGATGAAAAAAGTGACTGGAGTAGCATGGTTCTAATTTTAGAAATTTCCAGTGACATGTAGCCGATATAACGAATAATAGTGACATTTTTTTATT

Reverse complement sequence

AATAAAAAAATGTCACTATTATTCGTTATATCGGCTACATGTCACTGGAAATTTCTAAAATTAGAACCATGCTACTCCAGTCACTTTTTTCATCCTCCTC[T/C]
CTCATACCGTCTCCGTTCCTGTCTCATTCCGACCACCGCGGCGGACTTCCCGACGAGGGCGGCATCGACGGCGAACTGGGTGAGGAGGTCCGGGTGAGTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.60% 3.20% 0.21% 0.00% NA
All Indica  2759 96.00% 3.80% 0.18% 0.00% NA
All Japonica  1512 96.90% 2.80% 0.33% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 82.20% 17.00% 0.86% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 96.70% 3.20% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 91.90% 7.30% 0.79% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0525073369 A -> G LOC_Os05g43180.1 upstream_gene_variant ; 382.0bp to feature; MODIFIER silent_mutation Average:57.43; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0525073369 A -> G LOC_Os05g43190.1 downstream_gene_variant ; 4555.0bp to feature; MODIFIER silent_mutation Average:57.43; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0525073369 A -> G LOC_Os05g43180-LOC_Os05g43190 intergenic_region ; MODIFIER silent_mutation Average:57.43; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0525073369 NA 5.32E-08 mr1896 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525073369 2.01E-06 8.38E-11 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525073369 NA 7.01E-10 mr1935 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525073369 NA 3.19E-09 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525073369 NA 4.91E-06 mr1199_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525073369 NA 4.07E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525073369 NA 9.27E-06 mr1567_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525073369 5.64E-08 2.77E-12 mr1828_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525073369 NA 3.40E-10 mr1907_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525073369 NA 2.28E-08 mr1934_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525073369 NA 7.60E-07 mr1938_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251