\
| Variant ID: vg0525073369 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 25073369 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 127. )
GACTCACCCGGACCTCCTCACCCAGTTCGCCGTCGATGCCGCCCTCGTCGGGAAGTCCGCCGCGGTGGTCGGAATGAGACAGGAACGGAGACGGTATGAG[A/G]
GAGGAGGATGAAAAAAGTGACTGGAGTAGCATGGTTCTAATTTTAGAAATTTCCAGTGACATGTAGCCGATATAACGAATAATAGTGACATTTTTTTATT
AATAAAAAAATGTCACTATTATTCGTTATATCGGCTACATGTCACTGGAAATTTCTAAAATTAGAACCATGCTACTCCAGTCACTTTTTTCATCCTCCTC[T/C]
CTCATACCGTCTCCGTTCCTGTCTCATTCCGACCACCGCGGCGGACTTCCCGACGAGGGCGGCATCGACGGCGAACTGGGTGAGGAGGTCCGGGTGAGTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.60% | 3.20% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 96.00% | 3.80% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 96.90% | 2.80% | 0.33% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 82.20% | 17.00% | 0.86% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.70% | 3.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 91.90% | 7.30% | 0.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0525073369 | A -> G | LOC_Os05g43180.1 | upstream_gene_variant ; 382.0bp to feature; MODIFIER | silent_mutation | Average:57.43; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg0525073369 | A -> G | LOC_Os05g43190.1 | downstream_gene_variant ; 4555.0bp to feature; MODIFIER | silent_mutation | Average:57.43; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg0525073369 | A -> G | LOC_Os05g43180-LOC_Os05g43190 | intergenic_region ; MODIFIER | silent_mutation | Average:57.43; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0525073369 | NA | 5.32E-08 | mr1896 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525073369 | 2.01E-06 | 8.38E-11 | mr1934 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525073369 | NA | 7.01E-10 | mr1935 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525073369 | NA | 3.19E-09 | mr1195_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525073369 | NA | 4.91E-06 | mr1199_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525073369 | NA | 4.07E-06 | mr1482_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525073369 | NA | 9.27E-06 | mr1567_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525073369 | 5.64E-08 | 2.77E-12 | mr1828_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525073369 | NA | 3.40E-10 | mr1907_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525073369 | NA | 2.28E-08 | mr1934_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0525073369 | NA | 7.60E-07 | mr1938_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |