\
| Variant ID: vg0524983984 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 24983984 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGTGCATATTCCTGAACAAGATGCTTCCATAGTTAGTCAATTCAGCATGAAGACGAAATTATGTTCTGATCATAGTTTGAAGATTTCCGATACATACCTG[C/T]
GGAGGCGGATTGAATGCATTATATGGCACGACTGGCAGCTGGTGTGAGTAGCTGACGACGATTGCATTTGAGAAGATTTTATACATCCTCTCCTTCATGA
TCATGAAGGAGAGGATGTATAAAATCTTCTCAAATGCAATCGTCGTCAGCTACTCACACCAGCTGCCAGTCGTGCCATATAATGCATTCAATCCGCCTCC[G/A]
CAGGTATGTATCGGAAATCTTCAAACTATGATCAGAACATAATTTCGTCTTCATGCTGAATTGACTAACTATGGAAGCATCTTGTTCAGGAATATGCACT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.80% | 2.60% | 3.55% | 53.00% | NA |
| All Indica | 2759 | 10.50% | 4.20% | 5.58% | 79.74% | NA |
| All Japonica | 1512 | 99.10% | 0.20% | 0.20% | 0.53% | NA |
| Aus | 269 | 4.80% | 1.50% | 1.49% | 92.19% | NA |
| Indica I | 595 | 3.70% | 4.40% | 3.19% | 88.74% | NA |
| Indica II | 465 | 25.60% | 1.70% | 11.40% | 61.29% | NA |
| Indica III | 913 | 7.20% | 5.80% | 4.60% | 82.37% | NA |
| Indica Intermediate | 786 | 10.40% | 3.70% | 5.09% | 80.79% | NA |
| Temperate Japonica | 767 | 98.80% | 0.40% | 0.26% | 0.52% | NA |
| Tropical Japonica | 504 | 99.00% | 0.00% | 0.20% | 0.79% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 88.50% | 0.00% | 0.00% | 11.46% | NA |
| Intermediate | 90 | 50.00% | 0.00% | 7.78% | 42.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0524983984 | C -> T | LOC_Os05g43020.1 | synonymous_variant ; p.Pro294Pro; LOW | synonymous_codon | Average:5.139; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0524983984 | C -> DEL | LOC_Os05g43020.1 | N | frameshift_variant | Average:5.139; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0524983984 | NA | 8.65E-08 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524983984 | NA | 1.37E-06 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524983984 | NA | 9.35E-06 | mr1415 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524983984 | 2.05E-06 | 2.05E-06 | mr1492 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524983984 | NA | 9.35E-06 | mr1567 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524983984 | NA | 1.02E-24 | mr1903 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524983984 | NA | 1.92E-15 | mr1162_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524983984 | NA | 9.78E-20 | mr1195_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524983984 | NA | 9.24E-06 | mr1359_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524983984 | NA | 1.86E-12 | mr1520_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524983984 | NA | 4.85E-08 | mr1654_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0524983984 | NA | 1.45E-08 | mr1907_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |